Incidental Mutation 'R3420:Cyp2b9'
ID267011
Institutional Source Beutler Lab
Gene Symbol Cyp2b9
Ensembl Gene ENSMUSG00000040660
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms16\alphaoh-a, phenobarbitol inducible, type a, Cyp2b
MMRRC Submission 040638-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3420 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26173411-26210661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26210103 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 432 (G432E)
Ref Sequence ENSEMBL: ENSMUSP00000080846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082214]
Predicted Effect probably damaging
Transcript: ENSMUST00000082214
AA Change: G432E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080846
Gene: ENSMUSG00000040660
AA Change: G432E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 1.7e-146 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Celsr2 A G 3: 108,414,416 V360A probably benign Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
Dclre1b A G 3: 103,808,096 Y29H probably damaging Het
Enthd1 T C 15: 80,560,024 D110G probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Klb G A 5: 65,372,142 G338S probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Prps2 G A X: 167,382,508 probably null Het
Prss23 C A 7: 89,509,899 V321L possibly damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Washc1 T C 17: 66,117,033 S247P probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Other mutations in Cyp2b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cyp2b9 APN 7 26198505 missense probably damaging 0.99
IGL01133:Cyp2b9 APN 7 26210235 missense probably damaging 1.00
IGL01331:Cyp2b9 APN 7 26187715 missense probably damaging 0.99
IGL02281:Cyp2b9 APN 7 26201104 missense probably damaging 0.99
IGL02502:Cyp2b9 APN 7 26187814 critical splice donor site probably null
IGL02713:Cyp2b9 APN 7 26173520 missense probably benign 0.12
IGL03032:Cyp2b9 APN 7 26198600 splice site probably benign
IGL03307:Cyp2b9 APN 7 26199051 missense probably benign 0.00
R0010:Cyp2b9 UTSW 7 26186753 splice site probably benign
R0025:Cyp2b9 UTSW 7 26200813 missense probably benign 0.09
R0040:Cyp2b9 UTSW 7 26173474 missense possibly damaging 0.68
R0184:Cyp2b9 UTSW 7 26187007 nonsense probably null
R0370:Cyp2b9 UTSW 7 26210106 missense probably damaging 1.00
R1595:Cyp2b9 UTSW 7 26200907 missense possibly damaging 0.72
R1751:Cyp2b9 UTSW 7 26186675 missense probably benign 0.05
R1835:Cyp2b9 UTSW 7 26200783 missense probably benign
R1879:Cyp2b9 UTSW 7 26198569 missense probably damaging 0.99
R2256:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2257:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2418:Cyp2b9 UTSW 7 26186707 missense probably benign 0.00
R4088:Cyp2b9 UTSW 7 26173456 missense probably damaging 0.99
R4412:Cyp2b9 UTSW 7 26198443 missense probably damaging 1.00
R4495:Cyp2b9 UTSW 7 26200755 missense probably benign 0.00
R4615:Cyp2b9 UTSW 7 26201125 missense probably damaging 1.00
R5375:Cyp2b9 UTSW 7 26187742 missense probably damaging 1.00
R5426:Cyp2b9 UTSW 7 26187655 missense probably benign
R5862:Cyp2b9 UTSW 7 26187807 missense probably benign 0.01
R6237:Cyp2b9 UTSW 7 26173574 missense probably benign 0.02
R6445:Cyp2b9 UTSW 7 26186987 missense probably benign 0.13
R6992:Cyp2b9 UTSW 7 26201139 missense probably benign 0.00
R7515:Cyp2b9 UTSW 7 26199171 missense probably damaging 1.00
R7654:Cyp2b9 UTSW 7 26186942 missense possibly damaging 0.72
R7816:Cyp2b9 UTSW 7 26201092 missense probably benign 0.01
R7850:Cyp2b9 UTSW 7 26186686 nonsense probably null
R7933:Cyp2b9 UTSW 7 26186686 nonsense probably null
Z1177:Cyp2b9 UTSW 7 26201163 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACTGCACATGAGCTTTTGGG -3'
(R):5'- CTAAGAAGTAGATCTGGTGTGCTG -3'

Sequencing Primer
(F):5'- CACATGAGCTTTTGGGTCTGG -3'
(R):5'- GTGCTGGAGGTATTTTTCCAATAC -3'
Posted On2015-02-18