Incidental Mutation 'R3420:Enthd1'
ID267017
Institutional Source Beutler Lab
Gene Symbol Enthd1
Ensembl Gene ENSMUSG00000050439
Gene NameENTH domain containing 1
SynonymsLOC383075
MMRRC Submission 040638-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3420 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location80452240-80565156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80560024 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 110 (D110G)
Ref Sequence ENSEMBL: ENSMUSP00000155166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096347] [ENSMUST00000229110]
Predicted Effect probably damaging
Transcript: ENSMUST00000096347
AA Change: D110G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094072
Gene: ENSMUSG00000050439
AA Change: D110G

DomainStartEndE-ValueType
ENTH 15 141 1.53e-50 SMART
low complexity region 419 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229110
AA Change: D110G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Celsr2 A G 3: 108,414,416 V360A probably benign Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
Cyp2b9 G A 7: 26,210,103 G432E probably damaging Het
Dclre1b A G 3: 103,808,096 Y29H probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Klb G A 5: 65,372,142 G338S probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Prps2 G A X: 167,382,508 probably null Het
Prss23 C A 7: 89,509,899 V321L possibly damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Washc1 T C 17: 66,117,033 S247P probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Other mutations in Enthd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Enthd1 APN 15 80452451 missense probably damaging 0.98
IGL02127:Enthd1 APN 15 80452742 missense probably damaging 1.00
PIT4151001:Enthd1 UTSW 15 80452736 missense probably damaging 1.00
R0190:Enthd1 UTSW 15 80534494 splice site probably null
R1237:Enthd1 UTSW 15 80534598 missense probably damaging 1.00
R1616:Enthd1 UTSW 15 80452385 missense probably damaging 1.00
R1697:Enthd1 UTSW 15 80452923 missense probably damaging 1.00
R1826:Enthd1 UTSW 15 80474281 missense probably damaging 0.99
R2037:Enthd1 UTSW 15 80560349 missense possibly damaging 0.86
R3814:Enthd1 UTSW 15 80452682 missense probably benign 0.11
R4049:Enthd1 UTSW 15 80560039 missense probably damaging 0.99
R4403:Enthd1 UTSW 15 80452824 missense probably benign 0.00
R4720:Enthd1 UTSW 15 80560309 missense probably damaging 1.00
R6062:Enthd1 UTSW 15 80452715 missense probably damaging 0.96
R6143:Enthd1 UTSW 15 80509286 missense possibly damaging 0.96
R6984:Enthd1 UTSW 15 80560108 missense probably damaging 1.00
R7062:Enthd1 UTSW 15 80452544 missense probably damaging 1.00
R7105:Enthd1 UTSW 15 80509209 missense probably benign 0.17
R7177:Enthd1 UTSW 15 80474214 missense probably damaging 1.00
R7261:Enthd1 UTSW 15 80560215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGCCCAGGGTGATAACAGG -3'
(R):5'- CCTCTCGGAGATCATGCACATG -3'

Sequencing Primer
(F):5'- GGTGCACATCAACCTAGCG -3'
(R):5'- AACGGCTCCAGGAAAGTT -3'
Posted On2015-02-18