Incidental Mutation 'R3421:Mr1'
ID267027
Institutional Source Beutler Lab
Gene Symbol Mr1
Ensembl Gene ENSMUSG00000026471
Gene Namemajor histocompatibility complex, class I-related
SynonymsH2ls, MR1
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3421 (G1)
Quality Score161
Status Validated
Chromosome1
Chromosomal Location155127277-155146814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155137591 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 80 (Y80C)
Ref Sequence ENSEMBL: ENSMUSP00000027744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027744] [ENSMUST00000192410] [ENSMUST00000194612]
Predicted Effect probably damaging
Transcript: ENSMUST00000027744
AA Change: Y80C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027744
Gene: ENSMUSG00000026471
AA Change: Y80C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 19 194 1.8e-59 PFAM
Pfam:MHC_I_3 46 193 3.9e-12 PFAM
IGc1 213 284 1.51e-12 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191773
Predicted Effect probably benign
Transcript: ENSMUST00000192410
SMART Domains Protein: ENSMUSP00000141476
Gene: ENSMUSG00000026471

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 19 87 8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194612
SMART Domains Protein: ENSMUSP00000142195
Gene: ENSMUSG00000026471

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:4NQE|C 19 44 3e-7 PDB
SCOP:d1de4a2 19 44 3e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195579
Meta Mutation Damage Score 0.4852 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAIT (mucosal-associated invariant T-cells) lymphocytes represent a small population of T-cells primarily found in the gut. The protein encoded by this gene is an antigen-presenting molecule that presents metabolites of microbial vitamin B to MAITs. This presentation may activate the MAITs to regulate the amounts of specific types of bacteria in the gut. Several transcript variants encoding different isoforms have been found for this gene, and a pseudogene of it has been detected about 36 kbp upstream on the same chromosome. [provided by RefSeq, Jul 2015]
PHENOTYPE: Null homozyogtes lack mucosal-associated invariant T cells that express the canonical mVa19-Ja33 rearrangement of the Tcra gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Mr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03216:Mr1 APN 1 155129289 missense possibly damaging 0.51
R0612:Mr1 UTSW 1 155137690 missense probably damaging 1.00
R1388:Mr1 UTSW 1 155132503 missense probably damaging 0.98
R1655:Mr1 UTSW 1 155132455 missense probably benign 0.05
R2157:Mr1 UTSW 1 155146630 critical splice donor site probably null
R2437:Mr1 UTSW 1 155132531 missense probably benign 0.07
R4224:Mr1 UTSW 1 155130719 missense possibly damaging 0.62
R4240:Mr1 UTSW 1 155136667 missense probably damaging 1.00
R4711:Mr1 UTSW 1 155136590 missense probably benign 0.00
R4849:Mr1 UTSW 1 155130690 missense probably benign 0.00
R5915:Mr1 UTSW 1 155136788 missense probably damaging 1.00
R6882:Mr1 UTSW 1 155132453 missense possibly damaging 0.54
R6940:Mr1 UTSW 1 155129268 makesense probably null
R7315:Mr1 UTSW 1 155129290 missense probably benign
R7567:Mr1 UTSW 1 155146728 start gained probably benign
R7751:Mr1 UTSW 1 155129308 missense probably damaging 1.00
R7818:Mr1 UTSW 1 155130636 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATGGTGGTCACTGAACTCC -3'
(R):5'- CGCTGAGATATTTTCGTCTAGC -3'

Sequencing Primer
(F):5'- GAACTCCAGCAACCTGATTTTCTAAG -3'
(R):5'- GTCTAGCTGTTTCCGATCCTGG -3'
Posted On2015-02-18