Mutagenetix > Incidental Mutations

Incidental Mutation 'R3421:Dtx2'

267038

Institutional Source

Beutler Lab

Gene Symbol

Dtx2

Ensembl Gene

ENSMUSG00000004947

Gene Name

deltex 2, E3 ubiquitin ligase

Synonyms

MMRRC Submission

040639-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3421 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135994800-136032872 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 136012478 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 246 (Y246N)

Ref Sequence

ENSEMBL: ENSMUSP00000115122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005072] [ENSMUST00000111142] [ENSMUST00000111144] [ENSMUST00000111145] [ENSMUST00000125827] [ENSMUST00000130345] [ENSMUST00000199239]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005072
AA Change: Y246N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005072
Gene: ENSMUSG00000004947
AA Change: Y246N

Domain	Start	End	E-Value	Type
WWE	17	105	2.02e-31	SMART
WWE	107	182	6.98e-26	SMART
low complexity region	281	318	N/A	INTRINSIC
RING	408	468	2.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111142
AA Change: Y246N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106772
Gene: ENSMUSG00000004947
AA Change: Y246N

Domain	Start	End	E-Value	Type
WWE	17	105	2.02e-31	SMART
WWE	107	182	6.98e-26	SMART
low complexity region	281	318	N/A	INTRINSIC
RING	409	469	2.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111144
AA Change: Y246N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106774
Gene: ENSMUSG00000004947
AA Change: Y246N

Domain	Start	End	E-Value	Type
WWE	17	105	2.02e-31	SMART
WWE	107	182	6.98e-26	SMART
low complexity region	281	318	N/A	INTRINSIC
RING	363	423	2.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111145
AA Change: Y246N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106775
Gene: ENSMUSG00000004947
AA Change: Y246N

Domain	Start	End	E-Value	Type
WWE	17	105	2.02e-31	SMART
WWE	107	182	6.98e-26	SMART
low complexity region	281	318	N/A	INTRINSIC
RING	363	423	2.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125827
AA Change: Y246N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115122
Gene: ENSMUSG00000004947
AA Change: Y246N

Domain	Start	End	E-Value	Type
WWE	17	105	2.02e-31	SMART
WWE	107	182	6.98e-26	SMART
low complexity region	281	318	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130345

Predicted Effect

probably benign
Transcript: ENSMUST00000199239

SMART Domains

Protein: ENSMUSP00000142472
Gene: ENSMUSG00000004947

Domain	Start	End	E-Value	Type
WWE	17	105	8.4e-34	SMART
WWE	107	151	3.9e-4	SMART

Meta Mutation Damage Score

0.1382

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX2 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal with no detectable abnormalities in T or B cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	A	5: 114,212,636		probably null	Het
Agbl3	A	G	6: 34,793,965	T132A	probably benign	Het
Amn1	A	T	6: 149,169,452	L196*	probably null	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
Armc4	T	C	18: 7,223,523		probably benign	Het
Atp7b	C	T	8: 22,028,670	D51N	probably damaging	Het
Brip1	A	T	11: 86,152,669	Y356*	probably null	Het
Ccdc40	C	T	11: 119,234,779	P348L	probably benign	Het
Chrdl2	G	A	7: 100,023,868	C9Y	probably damaging	Het
Chst4	T	C	8: 110,030,406	D192G	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
D930048N14Rik	T	C	11: 51,654,958	*226R	probably null	Het
Dmgdh	T	C	13: 93,711,361	V522A	probably benign	Het
Fam19a1	C	A	6: 96,649,138	D112E	probably damaging	Het
Gtf2ird1	T	A	5: 134,388,500	M518L	probably benign	Het
Hoxc6	T	A	15: 103,010,895	W188R	probably damaging	Het
Igfn1	C	T	1: 135,976,917		probably null	Het
Kcnip1	A	G	11: 33,645,594	V43A	probably damaging	Het
Kif4-ps	A	T	12: 101,146,971	E453V	probably damaging	Het
Kifap3	T	A	1: 163,794,026	I81N	probably damaging	Het
Mgat4d	T	C	8: 83,358,143	S172P	probably damaging	Het
Mr1	T	C	1: 155,137,591	Y80C	probably damaging	Het
Nuak2	A	G	1: 132,332,080	D532G	probably benign	Het
Olfr1230	C	G	2: 89,296,553	S239T	probably benign	Het
Olfr1288	A	G	2: 111,478,952	H56R	probably benign	Het
Olfr20	A	G	11: 73,354,634	N294D	probably damaging	Het
Olfr26	A	G	9: 38,855,325	K88E	possibly damaging	Het
Olfr725	T	C	14: 50,034,540	T288A	possibly damaging	Het
Pik3cg	A	T	12: 32,204,739	F416L	probably damaging	Het
Prex1	A	G	2: 166,617,854	V124A	probably damaging	Het
Psmb2	T	C	4: 126,677,837	M28T	probably damaging	Het
Ric1	T	C	19: 29,567,590	I230T	probably damaging	Het
Saysd1	T	A	14: 20,082,926	K54N	probably benign	Het
Slc25a17	C	T	15: 81,360,700	V11I	probably benign	Het
Slc5a4a	T	C	10: 76,176,573	V359A	probably benign	Het
Slc7a3	T	A	X: 101,080,875		probably benign	Het
Slco1a5	A	T	6: 142,268,238	D52E	possibly damaging	Het
Soat2	T	C	15: 102,156,809		probably benign	Het
Telo2	C	T	17: 25,110,752	R262Q	probably damaging	Het
Zdhhc14	T	A	17: 5,753,091	*490R	probably null	Het
Zfp217	A	G	2: 170,120,017	F130S	possibly damaging	Het
Zfp712	C	T	13: 67,052,392	V10M	probably damaging	Het

Other mutations in Dtx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01077:Dtx2	APN	5	136029203	missense	possibly damaging	0.95
IGL01536:Dtx2	APN	5	136010086	utr 5 prime	probably benign
IGL01584:Dtx2	APN	5	136026566	missense	possibly damaging	0.49
IGL01782:Dtx2	APN	5	136010127	nonsense	probably null
IGL03091:Dtx2	APN	5	136012374	missense	probably damaging	1.00
R0499:Dtx2	UTSW	5	136029103	missense	probably damaging	1.00
R0580:Dtx2	UTSW	5	136032326	missense	probably damaging	1.00
R1988:Dtx2	UTSW	5	136032293	nonsense	probably null
R2062:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2063:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2064:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2065:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2068:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2108:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2110:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2111:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2130:Dtx2	UTSW	5	136012040	missense	probably damaging	0.96
R2146:Dtx2	UTSW	5	136030610	missense	probably benign	0.21
R3108:Dtx2	UTSW	5	136021816	missense	probably benign	0.01
R4467:Dtx2	UTSW	5	136012076	missense	probably damaging	1.00
R4741:Dtx2	UTSW	5	136026517	missense	probably benign	0.00
R5083:Dtx2	UTSW	5	136012190	missense	probably damaging	1.00
R5318:Dtx2	UTSW	5	136012100	missense	possibly damaging	0.92
R5705:Dtx2	UTSW	5	136010295	missense	probably damaging	1.00
R5964:Dtx2	UTSW	5	136023699	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTCAGACATCGCTGTTCCACG -3'
(R):5'- GCTTTCCACACGGGTAGAAG -3'

Sequencing Primer
(F):5'- CGCCAAATGGGACTTATCTGC -3'
(R):5'- CTTTCCACACGGGTAGAAGTAAAGTC -3'

Posted On

2015-02-18