Incidental Mutation 'R3421:Fam19a1'
ID267040
Institutional Source Beutler Lab
Gene Symbol Fam19a1
Ensembl Gene ENSMUSG00000059187
Gene Namefamily with sequence similarity 19, member A1
SynonymsC630007B19Rik, Tafa-1
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location96113154-96657198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96649138 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 112 (D112E)
Ref Sequence ENSEMBL: ENSMUSP00000113152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075080] [ENSMUST00000122120]
Predicted Effect probably damaging
Transcript: ENSMUST00000075080
AA Change: D112E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074589
Gene: ENSMUSG00000059187
AA Change: D112E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 40 129 3.9e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122120
AA Change: D112E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113152
Gene: ENSMUSG00000059187
AA Change: D112E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 41 129 4e-50 PFAM
Meta Mutation Damage Score 0.2114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Fam19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2039:Fam19a1 UTSW 6 96654764 splice site probably null
R3420:Fam19a1 UTSW 6 96649138 missense probably damaging 1.00
R3422:Fam19a1 UTSW 6 96649138 missense probably damaging 1.00
R5745:Fam19a1 UTSW 6 96649185 missense probably damaging 0.99
R6175:Fam19a1 UTSW 6 96115740 missense probably benign 0.03
R7318:Fam19a1 UTSW 6 96115756 critical splice donor site probably null
R7746:Fam19a1 UTSW 6 96115756 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTAGCAGATGGAGGTAGGC -3'
(R):5'- ATCGATGGACACTGACCCAC -3'

Sequencing Primer
(F):5'- CCTCCTTGCTGCAGAGAAC -3'
(R):5'- ACCTAGTTCAGAATACGTCCTG -3'
Posted On2015-02-18