Incidental Mutation 'R3421:Slco1a5'
ID267041
Institutional Source Beutler Lab
Gene Symbol Slco1a5
Ensembl Gene ENSMUSG00000063975
Gene Namesolute carrier organic anion transporter family, member 1a5
SynonymsOatp3, Slc21a7
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142234227-142322981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142268238 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 52 (D52E)
Ref Sequence ENSEMBL: ENSMUSP00000124829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081380] [ENSMUST00000111825] [ENSMUST00000128446] [ENSMUST00000153268]
Predicted Effect probably benign
Transcript: ENSMUST00000081380
AA Change: D52E

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080116
Gene: ENSMUSG00000063975
AA Change: D52E

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 4.3e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111822
Predicted Effect probably benign
Transcript: ENSMUST00000111825
AA Change: D52E

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137607
Gene: ENSMUSG00000063975
AA Change: D52E

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 5.8e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128446
AA Change: D10E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124987
Gene: ENSMUSG00000063975
AA Change: D10E

DomainStartEndE-ValueType
Pfam:OATP 1 157 6.1e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153268
AA Change: D52E

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124829
Gene: ENSMUSG00000063975
AA Change: D52E

DomainStartEndE-ValueType
Pfam:OATP 19 74 3.4e-16 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased percentage of CD8 ells and increased percentage of B cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Slco1a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Slco1a5 APN 6 142242150 missense probably benign 0.00
IGL01432:Slco1a5 APN 6 142236286 missense possibly damaging 0.59
IGL01590:Slco1a5 APN 6 142250319 missense probably benign 0.01
IGL01824:Slco1a5 APN 6 142253037 missense probably benign 0.01
IGL01915:Slco1a5 APN 6 142243873 missense probably benign 0.00
IGL01945:Slco1a5 APN 6 142243989 critical splice acceptor site probably null
IGL02078:Slco1a5 APN 6 142254446 missense probably benign 0.30
IGL02178:Slco1a5 APN 6 142262688 nonsense probably null
IGL02366:Slco1a5 APN 6 142250215 missense possibly damaging 0.57
IGL02395:Slco1a5 APN 6 142275487 missense probably damaging 0.99
IGL02621:Slco1a5 APN 6 142242015 missense probably benign 0.10
IGL02752:Slco1a5 APN 6 142262712 missense probably benign 0.07
IGL02940:Slco1a5 APN 6 142242005 missense probably damaging 1.00
IGL03065:Slco1a5 APN 6 142248843 splice site probably benign
IGL03377:Slco1a5 APN 6 142234766 missense probably benign 0.01
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0230:Slco1a5 UTSW 6 142236328 splice site probably benign
R0690:Slco1a5 UTSW 6 142268278 missense probably benign 0.24
R1217:Slco1a5 UTSW 6 142254374 missense probably damaging 0.98
R1900:Slco1a5 UTSW 6 142242063 missense probably benign 0.44
R2084:Slco1a5 UTSW 6 142234711 missense probably benign 0.32
R2393:Slco1a5 UTSW 6 142248775 missense possibly damaging 0.85
R2414:Slco1a5 UTSW 6 142236250 missense probably damaging 1.00
R2760:Slco1a5 UTSW 6 142250271 missense probably benign 0.00
R3420:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3827:Slco1a5 UTSW 6 142253249 missense probably damaging 0.97
R3963:Slco1a5 UTSW 6 142248644 critical splice donor site probably null
R3977:Slco1a5 UTSW 6 142258972 splice site probably benign
R4074:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4075:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4076:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4782:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4799:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4831:Slco1a5 UTSW 6 142234705 missense probably benign
R5038:Slco1a5 UTSW 6 142262637 missense probably benign 0.01
R5038:Slco1a5 UTSW 6 142266364 missense probably damaging 1.00
R5063:Slco1a5 UTSW 6 142259065 missense probably damaging 1.00
R5273:Slco1a5 UTSW 6 142242098 missense probably benign 0.00
R5436:Slco1a5 UTSW 6 142254392 missense probably damaging 1.00
R5579:Slco1a5 UTSW 6 142242125 missense possibly damaging 0.93
R5602:Slco1a5 UTSW 6 142275529 start gained probably benign
R5643:Slco1a5 UTSW 6 142237594 splice site probably null
R5644:Slco1a5 UTSW 6 142237594 splice site probably null
R5686:Slco1a5 UTSW 6 142236307 missense probably damaging 1.00
R5699:Slco1a5 UTSW 6 142248816 missense probably damaging 0.96
R5792:Slco1a5 UTSW 6 142242113 missense probably damaging 1.00
R5938:Slco1a5 UTSW 6 142248717 missense probably damaging 0.97
R5997:Slco1a5 UTSW 6 142253113 missense probably benign 0.19
R6146:Slco1a5 UTSW 6 142234808 missense probably benign
R6377:Slco1a5 UTSW 6 142242180 splice site probably null
R6466:Slco1a5 UTSW 6 142237534 missense probably benign 0.01
R6523:Slco1a5 UTSW 6 142266395 missense probably damaging 1.00
R7092:Slco1a5 UTSW 6 142248675 missense probably benign
R7207:Slco1a5 UTSW 6 142248749 nonsense probably null
R7356:Slco1a5 UTSW 6 142234732 missense probably benign 0.01
R7430:Slco1a5 UTSW 6 142248712 missense probably benign 0.00
R7445:Slco1a5 UTSW 6 142259008 missense possibly damaging 0.93
R7499:Slco1a5 UTSW 6 142262531 intron probably null
R7579:Slco1a5 UTSW 6 142275481 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGCTTCTTCACACTAAATCCAG -3'
(R):5'- CATGGCAGAGCAGAGATTACAC -3'

Sequencing Primer
(F):5'- GCTATTTCATCACCATTAAGACGC -3'
(R):5'- GGATACAGTCATCCATCTCATTGTGG -3'
Posted On2015-02-18