Incidental Mutation 'R3421:Amn1'
ID267042
Institutional Source Beutler Lab
Gene Symbol Amn1
Ensembl Gene ENSMUSG00000068250
Gene Nameantagonist of mitotic exit network 1
Synonyms
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location149157147-149188712 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 149169452 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 196 (L196*)
Ref Sequence ENSEMBL: ENSMUSP00000107160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095319] [ENSMUST00000111535] [ENSMUST00000141346]
Predicted Effect probably null
Transcript: ENSMUST00000095319
AA Change: L153*
SMART Domains Protein: ENSMUSP00000092957
Gene: ENSMUSG00000068250
AA Change: L153*

DomainStartEndE-ValueType
LRR 17 41 2.82e0 SMART
LRR 42 70 1.52e2 SMART
LRR 71 96 1.25e-1 SMART
LRR 97 122 3.89e-3 SMART
LRR 123 147 1.44e1 SMART
LRR 150 175 1.28e1 SMART
Blast:LRR 176 204 3e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111535
AA Change: L196*
SMART Domains Protein: ENSMUSP00000107160
Gene: ENSMUSG00000068250
AA Change: L196*

DomainStartEndE-ValueType
LRR 60 84 2.82e0 SMART
LRR 85 113 1.52e2 SMART
LRR 114 139 1.25e-1 SMART
LRR 140 165 3.89e-3 SMART
LRR 166 190 1.44e1 SMART
LRR 193 218 1.28e1 SMART
Blast:LRR 219 247 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134181
Predicted Effect probably benign
Transcript: ENSMUST00000141346
SMART Domains Protein: ENSMUSP00000116060
Gene: ENSMUSG00000068250

DomainStartEndE-ValueType
LRR 17 41 2.82e0 SMART
LRR 42 70 1.52e2 SMART
LRR 71 96 1.25e-1 SMART
LRR 97 121 1.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152062
Predicted Effect probably benign
Transcript: ENSMUST00000156864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204681
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Amn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Amn1 APN 6 149169446 critical splice donor site probably null
PIT4453001:Amn1 UTSW 6 149170859 missense probably benign 0.00
R0153:Amn1 UTSW 6 149188593 utr 5 prime probably benign
R0494:Amn1 UTSW 6 149185136 unclassified probably benign
R0557:Amn1 UTSW 6 149171005 missense possibly damaging 0.50
R0717:Amn1 UTSW 6 149183472 missense possibly damaging 0.88
R0736:Amn1 UTSW 6 149183472 missense possibly damaging 0.88
R3420:Amn1 UTSW 6 149169452 nonsense probably null
R4466:Amn1 UTSW 6 149166845 splice site probably null
R4760:Amn1 UTSW 6 149185113 missense probably benign
R5294:Amn1 UTSW 6 149185124 unclassified probably benign
R5356:Amn1 UTSW 6 149166894 missense possibly damaging 0.80
R5561:Amn1 UTSW 6 149185024 missense probably damaging 0.98
R7501:Amn1 UTSW 6 149185031 missense probably benign 0.19
R7564:Amn1 UTSW 6 149185031 missense probably benign 0.19
R7643:Amn1 UTSW 6 149185031 missense probably benign 0.19
R7645:Amn1 UTSW 6 149185031 missense probably benign 0.19
R8097:Amn1 UTSW 6 149169355 unclassified probably benign
X0064:Amn1 UTSW 6 149171035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCAGCAGGTTATCTCAGG -3'
(R):5'- GCCCCTAACTCAGAACAATGTATTTG -3'

Sequencing Primer
(F):5'- AGCAGGTTATCTCAGGTTTGTTGTAC -3'
(R):5'- AGGGGCATTGAACTCACTCTTAG -3'
Posted On2015-02-18