Incidental Mutation 'R3421:Chst4'
ID267047
Institutional Source Beutler Lab
Gene Symbol Chst4
Ensembl Gene ENSMUSG00000035930
Gene Namecarbohydrate (chondroitin 6/keratan) sulfotransferase 4
SynonymsGST-3, HEC-GlcNAc6ST, high endothelial cell GlcNAC-6-sulphotransferase
MMRRC Submission 040639-MU
Accession Numbers

Genbank: NM_011998;  MGI: 1349479

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110029153-110039740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110030406 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 192 (D192G)
Ref Sequence ENSEMBL: ENSMUSP00000148756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109222] [ENSMUST00000211894] [ENSMUST00000212934]
Predicted Effect probably damaging
Transcript: ENSMUST00000109222
AA Change: D192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104845
Gene: ENSMUSG00000035930
AA Change: D192G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Sulfotransfer_3 41 296 6.4e-15 PFAM
Pfam:Sulfotransfer_1 41 357 2.4e-26 PFAM
low complexity region 370 378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211894
AA Change: D275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212934
AA Change: D192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9394 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acetylglucosamine 6-O sulfotransferase. The encoded enzyme transfers sulfate from 3'phosphoadenosine 5'phospho-sulfate to the 6-hydroxyl group of N-acetylglucosamine on glycoproteins. This protein is localized to the Golgi and is involved in the modification of glycan structures on ligands of the lymphocyte homing receptor L-selectin. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene do not accumulate lymphocytes in peripheral lymph nodes to as great an extent as normal. The animals are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Chst4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Chst4 APN 8 110029965 missense probably benign 0.14
A4554:Chst4 UTSW 8 110029888 missense probably benign 0.09
R0091:Chst4 UTSW 8 110030665 missense probably damaging 1.00
R0373:Chst4 UTSW 8 110030394 missense probably damaging 1.00
R1171:Chst4 UTSW 8 110030623 missense probably damaging 1.00
R1577:Chst4 UTSW 8 110029844 missense probably benign 0.00
R2377:Chst4 UTSW 8 110030172 missense possibly damaging 0.80
R5514:Chst4 UTSW 8 110029974 missense probably damaging 1.00
R6793:Chst4 UTSW 8 110030067 missense probably damaging 1.00
R7141:Chst4 UTSW 8 110030839 missense probably damaging 1.00
R7146:Chst4 UTSW 8 110030731 missense probably damaging 1.00
R7183:Chst4 UTSW 8 110029998 missense possibly damaging 0.72
R7732:Chst4 UTSW 8 110029882 nonsense probably null
R7871:Chst4 UTSW 8 110030913 missense probably damaging 1.00
R7954:Chst4 UTSW 8 110030913 missense probably damaging 1.00
Z1176:Chst4 UTSW 8 110030092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTTGACTATGTCCACC -3'
(R):5'- CTCTTCCAGTGGGAGCAAAG -3'

Sequencing Primer
(F):5'- GACTATGTCCACCTGGCTTTTG -3'
(R):5'- TGTGCTCAGCGCCTGTG -3'
Posted On2015-02-18