Incidental Mutation 'R3421:Slc5a4a'
ID 267049
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Name solute carrier family 5, member 4a
Synonyms
MMRRC Submission 040639-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R3421 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 75983285-76025099 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76012407 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 359 (V359A)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020450
AA Change: V359A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: V359A

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Meta Mutation Damage Score 0.1135 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,350,697 (GRCm39) probably null Het
Agbl3 A G 6: 34,770,900 (GRCm39) T132A probably benign Het
Amn1 A T 6: 149,070,950 (GRCm39) L196* probably null Het
Ap3b2 C T 7: 81,123,598 (GRCm39) probably benign Het
Atp7b C T 8: 22,518,686 (GRCm39) D51N probably damaging Het
Brip1 A T 11: 86,043,495 (GRCm39) Y356* probably null Het
Ccdc40 C T 11: 119,125,605 (GRCm39) P348L probably benign Het
Chrdl2 G A 7: 99,673,075 (GRCm39) C9Y probably damaging Het
Chst4 T C 8: 110,757,038 (GRCm39) D192G probably damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
D930048N14Rik T C 11: 51,545,785 (GRCm39) *226R probably null Het
Dmgdh T C 13: 93,847,869 (GRCm39) V522A probably benign Het
Dtx2 T A 5: 136,041,332 (GRCm39) Y246N probably damaging Het
Gtf2ird1 T A 5: 134,417,354 (GRCm39) M518L probably benign Het
Hoxc6 T A 15: 102,919,327 (GRCm39) W188R probably damaging Het
Igfn1 C T 1: 135,904,655 (GRCm39) probably null Het
Kcnip1 A G 11: 33,595,594 (GRCm39) V43A probably damaging Het
Kif4-ps A T 12: 101,113,230 (GRCm39) E453V probably damaging Het
Kifap3 T A 1: 163,621,595 (GRCm39) I81N probably damaging Het
Mgat4d T C 8: 84,084,772 (GRCm39) S172P probably damaging Het
Mr1 T C 1: 155,013,337 (GRCm39) Y80C probably damaging Het
Nuak2 A G 1: 132,259,818 (GRCm39) D532G probably benign Het
Odad2 T C 18: 7,223,523 (GRCm39) probably benign Het
Or1e1 A G 11: 73,245,460 (GRCm39) N294D probably damaging Het
Or4c123 C G 2: 89,126,897 (GRCm39) S239T probably benign Het
Or4g7 A G 2: 111,309,297 (GRCm39) H56R probably benign Het
Or4k15b T C 14: 50,271,997 (GRCm39) T288A possibly damaging Het
Or8d1 A G 9: 38,766,621 (GRCm39) K88E possibly damaging Het
Pik3cg A T 12: 32,254,738 (GRCm39) F416L probably damaging Het
Prex1 A G 2: 166,459,774 (GRCm39) V124A probably damaging Het
Psmb2 T C 4: 126,571,630 (GRCm39) M28T probably damaging Het
Ric1 T C 19: 29,544,990 (GRCm39) I230T probably damaging Het
Saysd1 T A 14: 20,132,994 (GRCm39) K54N probably benign Het
Slc25a17 C T 15: 81,244,901 (GRCm39) V11I probably benign Het
Slc7a3 T A X: 100,124,481 (GRCm39) probably benign Het
Slco1a5 A T 6: 142,213,964 (GRCm39) D52E possibly damaging Het
Soat2 T C 15: 102,065,244 (GRCm39) probably benign Het
Tafa1 C A 6: 96,626,099 (GRCm39) D112E probably damaging Het
Telo2 C T 17: 25,329,726 (GRCm39) R262Q probably damaging Het
Zdhhc14 T A 17: 5,803,366 (GRCm39) *490R probably null Het
Zfp217 A G 2: 169,961,937 (GRCm39) F130S possibly damaging Het
Zfp712 C T 13: 67,200,456 (GRCm39) V10M probably damaging Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 75,999,567 (GRCm39) missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76,017,508 (GRCm39) missense probably benign 0.00
IGL02629:Slc5a4a APN 10 75,983,413 (GRCm39) missense unknown
IGL02976:Slc5a4a APN 10 76,006,527 (GRCm39) missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 75,986,346 (GRCm39) missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 75,986,386 (GRCm39) missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76,014,031 (GRCm39) missense probably null 0.00
R0244:Slc5a4a UTSW 10 76,024,986 (GRCm39) missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76,018,556 (GRCm39) missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76,012,368 (GRCm39) missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76,013,995 (GRCm39) missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76,022,362 (GRCm39) missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76,025,103 (GRCm39) splice site probably null
R1857:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1942:Slc5a4a UTSW 10 75,983,422 (GRCm39) missense unknown
R2016:Slc5a4a UTSW 10 75,989,414 (GRCm39) missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76,013,915 (GRCm39) splice site probably null
R3420:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76,024,983 (GRCm39) missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76,017,489 (GRCm39) missense probably benign 0.42
R4523:Slc5a4a UTSW 10 75,984,196 (GRCm39) missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76,013,929 (GRCm39) nonsense probably null
R4538:Slc5a4a UTSW 10 76,013,929 (GRCm39) nonsense probably null
R4755:Slc5a4a UTSW 10 76,022,398 (GRCm39) missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76,014,065 (GRCm39) missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 75,983,428 (GRCm39) missense unknown
R5254:Slc5a4a UTSW 10 76,018,572 (GRCm39) nonsense probably null
R6083:Slc5a4a UTSW 10 75,983,431 (GRCm39) missense unknown
R6331:Slc5a4a UTSW 10 76,014,034 (GRCm39) missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 75,983,501 (GRCm39) critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 75,983,384 (GRCm39) missense unknown
R8785:Slc5a4a UTSW 10 75,986,238 (GRCm39) critical splice acceptor site probably benign
R8929:Slc5a4a UTSW 10 76,006,617 (GRCm39) missense probably benign 0.27
R8993:Slc5a4a UTSW 10 76,022,369 (GRCm39) missense probably benign 0.15
R9018:Slc5a4a UTSW 10 76,002,546 (GRCm39) missense possibly damaging 0.67
R9474:Slc5a4a UTSW 10 75,986,238 (GRCm39) critical splice acceptor site probably benign
R9567:Slc5a4a UTSW 10 76,022,396 (GRCm39) missense probably benign 0.08
R9648:Slc5a4a UTSW 10 76,002,608 (GRCm39) missense probably damaging 1.00
Z1177:Slc5a4a UTSW 10 76,018,681 (GRCm39) nonsense probably null
Z1177:Slc5a4a UTSW 10 76,002,578 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCGGACAAGTGTCTTTCCTC -3'
(R):5'- GTCCATCTCAGGAACATCTGG -3'

Sequencing Primer
(F):5'- AGTGTCTTTCCTCCCACACACAAG -3'
(R):5'- CTCTTGGCAATATGTGAAAGATGCCC -3'
Posted On 2015-02-18