Incidental Mutation 'R3421:Hoxc6'
ID267064
Institutional Source Beutler Lab
Gene Symbol Hoxc6
Ensembl Gene ENSMUSG00000001661
Gene Namehomeobox C6
SynonymsHox-3.3, Hox-6.1
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102998257-103011881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103010895 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 188 (W188R)
Ref Sequence ENSEMBL: ENSMUSP00000001711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001709] [ENSMUST00000001711]
Predicted Effect probably benign
Transcript: ENSMUST00000001709
SMART Domains Protein: ENSMUSP00000001709
Gene: ENSMUSG00000022485

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
HOX 155 217 3.03e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000001711
AA Change: W188R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001711
Gene: ENSMUSG00000001661
AA Change: W188R

DomainStartEndE-ValueType
HOX 141 203 2.39e-24 SMART
low complexity region 221 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Meta Mutation Damage Score 0.9750 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family, members of which encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC6, is one of several HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Alternatively spliced transcript variants encoding different isoforms have been identified for HOXC6. Transcript variant two includes the shared exon, and transcript variant one includes only gene-specific exons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a transformation of thoracic vertebra 2 to a form similar to that of T1. Mammary glands do not develop normally resulting in poor lactation and poor survival of pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Hoxc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02233:Hoxc6 APN 15 103009876 missense probably benign
R1155:Hoxc6 UTSW 15 103010847 missense probably damaging 1.00
R1613:Hoxc6 UTSW 15 103009585 start gained probably benign
R1978:Hoxc6 UTSW 15 103010007 critical splice donor site probably null
R3420:Hoxc6 UTSW 15 103010895 missense probably damaging 1.00
R4578:Hoxc6 UTSW 15 103009661 missense probably benign 0.04
R7543:Hoxc6 UTSW 15 103009754 missense probably damaging 1.00
R8075:Hoxc6 UTSW 15 103010893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGACGCCTTGCTGATTG -3'
(R):5'- TAAATACAGAGTGTGTGATTCGGG -3'

Sequencing Primer
(F):5'- AGGACGCCTTGCTGATTGTTTTTAG -3'
(R):5'- ATTCGGGGAGCTGGGATGAG -3'
Posted On2015-02-18