Incidental Mutation 'R3422:Grin1'
ID267072
Institutional Source Beutler Lab
Gene Symbol Grin1
Ensembl Gene ENSMUSG00000026959
Gene Nameglutamate receptor, ionotropic, NMDA1 (zeta 1)
SynonymsRgsc174, M100174, NR1, GluRzeta1, NMDAR1, Nmdar
MMRRC Submission 040640-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3422 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25291181-25319187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25303914 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 390 (G390D)
Ref Sequence ENSEMBL: ENSMUSP00000109956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028335] [ENSMUST00000114307] [ENSMUST00000114308] [ENSMUST00000114310] [ENSMUST00000114312] [ENSMUST00000114314] [ENSMUST00000114317] [ENSMUST00000114318]
Predicted Effect probably benign
Transcript: ENSMUST00000028335
AA Change: G369D

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028335
Gene: ENSMUSG00000026959
AA Change: G369D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 6.6e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.5e-18 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114307
AA Change: G369D

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109946
Gene: ENSMUSG00000026959
AA Change: G369D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114308
AA Change: G390D

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109947
Gene: ENSMUSG00000026959
AA Change: G390D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114310
AA Change: G390D

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109949
Gene: ENSMUSG00000026959
AA Change: G390D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 39 299 3.6e-24 PFAM
Blast:PBPe 352 420 9e-37 BLAST
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 8.4e-17 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114312
AA Change: G369D

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109951
Gene: ENSMUSG00000026959
AA Change: G369D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 5.9e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114314
AA Change: G369D

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109953
Gene: ENSMUSG00000026959
AA Change: G369D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1.1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.3e-19 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114317
AA Change: G390D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109956
Gene: ENSMUSG00000026959
AA Change: G390D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 7.7e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114318
AA Change: G390D

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109957
Gene: ENSMUSG00000026959
AA Change: G390D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8.4e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.4e-19 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153551
Meta Mutation Damage Score 0.4522 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a critical subunit of N-methyl-D-aspartate receptors, members of the glutamate receptor channel superfamily which are heteromeric protein complexes with multiple subunits arranged to form a ligand-gated ion channel. These subunits play a key role in the plasticity of synapses, which is believed to underlie memory and learning. Cell-specific factors are thought to control expression of different isoforms, possibly contributing to the functional diversity of the subunits. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutants lack whisker patterns in brain cortex, are ataxic and die neonatally of respiratory failure. Hypomorph mutants exhibit hyperactivity, stereotypy, and impaired social/sexual interactions. Mice homozygous for an ENU-induced allele exhibit abnormal behavior and neuron physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Ahnak A G 19: 9,005,708 D1452G probably benign Het
Ahnak A G 19: 9,006,752 D1800G probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brca2 A G 5: 150,543,121 T2117A possibly damaging Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Ifit1bl1 T G 19: 34,593,950 N369T probably benign Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Me2 C T 18: 73,791,194 A316T probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmt2 A G 2: 3,284,388 E31G possibly damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Nwd2 G T 5: 63,725,193 V63L possibly damaging Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Otub1 C T 19: 7,199,059 D237N probably damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Soat2 T C 15: 102,156,809 probably benign Het
Spink5 A G 18: 44,010,244 K756R probably benign Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Vsig2 G A 9: 37,541,479 V195I possibly damaging Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp91 G A 19: 12,770,292 A489V probably benign Het
Other mutations in Grin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Grin1 APN 2 25296967 missense possibly damaging 0.93
IGL01627:Grin1 APN 2 25318697 missense probably damaging 1.00
IGL02039:Grin1 APN 2 25305342 missense probably damaging 0.98
IGL02074:Grin1 APN 2 25298502 missense possibly damaging 0.81
IGL02083:Grin1 APN 2 25298501 missense possibly damaging 0.93
IGL03334:Grin1 APN 2 25298393 critical splice donor site probably null
IGL03349:Grin1 APN 2 25310436 missense probably benign
PIT4283001:Grin1 UTSW 2 25297852 missense probably damaging 1.00
R0038:Grin1 UTSW 2 25297459 missense probably null 0.82
R0829:Grin1 UTSW 2 25298448 missense probably benign 0.08
R1454:Grin1 UTSW 2 25292430 nonsense probably null
R1550:Grin1 UTSW 2 25305131 missense probably benign 0.01
R1969:Grin1 UTSW 2 25297915 missense probably benign 0.01
R2057:Grin1 UTSW 2 25316820 missense probably damaging 1.00
R2424:Grin1 UTSW 2 25318652 missense probably null 1.00
R2877:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R2878:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R3420:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3958:Grin1 UTSW 2 25313453 missense probably damaging 1.00
R4222:Grin1 UTSW 2 25297320 intron probably benign
R4224:Grin1 UTSW 2 25297320 intron probably benign
R4225:Grin1 UTSW 2 25297320 intron probably benign
R4409:Grin1 UTSW 2 25310439 missense possibly damaging 0.75
R4723:Grin1 UTSW 2 25294470 missense probably benign 0.30
R4775:Grin1 UTSW 2 25292463 missense possibly damaging 0.92
R4783:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4784:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4785:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4829:Grin1 UTSW 2 25318724 missense possibly damaging 0.47
R4915:Grin1 UTSW 2 25298553 intron probably benign
R5064:Grin1 UTSW 2 25303831 intron probably benign
R5103:Grin1 UTSW 2 25310421 missense probably benign
R5125:Grin1 UTSW 2 25296827 intron probably benign
R5215:Grin1 UTSW 2 25303907 missense probably benign 0.00
R5419:Grin1 UTSW 2 25298273 splice site probably null
R6119:Grin1 UTSW 2 25305158 missense probably damaging 1.00
R6616:Grin1 UTSW 2 25292110 missense possibly damaging 0.82
R6894:Grin1 UTSW 2 25295817 missense probably damaging 1.00
R7101:Grin1 UTSW 2 25296635 missense probably damaging 0.98
R7137:Grin1 UTSW 2 25313538 missense probably benign
R7544:Grin1 UTSW 2 25305074 missense probably benign 0.05
R7693:Grin1 UTSW 2 25318667 missense possibly damaging 0.93
R7872:Grin1 UTSW 2 25298190 missense probably benign 0.01
R7986:Grin1 UTSW 2 25295829 missense probably damaging 1.00
X0026:Grin1 UTSW 2 25305098 missense probably benign 0.22
Z1176:Grin1 UTSW 2 25297907 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGTATCCTCGAGGCTTCTC -3'
(R):5'- TCTTGAGACTAGGGCAGAGG -3'

Sequencing Primer
(F):5'- GTATCCTCGAGGCTTCTCTGTCTC -3'
(R):5'- AATGAGAGCTTGGGCCACTTG -3'
Posted On2015-02-18