Mutagenetix > Incidental Mutations

Incidental Mutation 'R3422:Agbl3'

267081

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

040640-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3422 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34793965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 132 (T132A)

Ref Sequence

ENSEMBL: ENSMUSP00000110669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably benign
Transcript: ENSMUST00000115016
AA Change: T132A

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: T132A

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115017
AA Change: T132A

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: T132A

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135304
AA Change: T132A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836
AA Change: T132A

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143474

Predicted Effect

probably benign
Transcript: ENSMUST00000148834
AA Change: T132A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836
AA Change: T132A

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202017

Meta Mutation Damage Score

0.2113

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (40/40)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	G	19: 9,005,708	D1452G	probably benign	Het
Ahnak	A	G	19: 9,006,752	D1800G	probably benign	Het
Armc4	T	C	18: 7,223,523		probably benign	Het
Atp7b	C	T	8: 22,028,670	D51N	probably damaging	Het
Brca2	A	G	5: 150,543,121	T2117A	possibly damaging	Het
Ccdc73	A	T	2: 104,951,947	K216M	probably null	Het
Ccdc73	G	A	2: 104,951,948		probably null	Het
Ckap5	T	A	2: 91,570,252	W650R	probably damaging	Het
D930048N14Rik	T	C	11: 51,654,958	*226R	probably null	Het
Fam19a1	C	A	6: 96,649,138	D112E	probably damaging	Het
Grin1	C	T	2: 25,303,914	G390D	probably damaging	Het
Ifit1bl1	T	G	19: 34,593,950	N369T	probably benign	Het
Kcnip1	A	G	11: 33,645,594	V43A	probably damaging	Het
Kifap3	T	A	1: 163,794,026	I81N	probably damaging	Het
Me2	C	T	18: 73,791,194	A316T	probably damaging	Het
Mgat4d	T	C	8: 83,358,143	S172P	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Nmt2	A	G	2: 3,284,388	E31G	possibly damaging	Het
Nuak2	A	G	1: 132,332,080	D532G	probably benign	Het
Nwd2	G	T	5: 63,725,193	V63L	possibly damaging	Het
Olfr20	A	G	11: 73,354,634	N294D	probably damaging	Het
Olfr725	T	C	14: 50,034,540	T288A	possibly damaging	Het
Otub1	C	T	19: 7,199,059	D237N	probably damaging	Het
Pik3cg	A	T	12: 32,204,739	F416L	probably damaging	Het
Psmb2	T	C	4: 126,677,837	M28T	probably damaging	Het
Saysd1	T	A	14: 20,082,926	K54N	probably benign	Het
Slc5a4a	T	C	10: 76,176,573	V359A	probably benign	Het
Slc7a3	T	A	X: 101,080,875		probably benign	Het
Soat2	T	C	15: 102,156,809		probably benign	Het
Spink5	A	G	18: 44,010,244	K756R	probably benign	Het
Tlr4	A	G	4: 66,839,536	I189V	probably benign	Het
Vsig2	G	A	9: 37,541,479	V195I	possibly damaging	Het
Zfp217	A	G	2: 170,120,017	F130S	possibly damaging	Het
Zfp91	G	A	19: 12,770,292	A489V	probably benign	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGCCATGAGTTGTGTTTACAG -3'
(R):5'- TTACAAAGGTGATCTGCAGATAGAG -3'

Sequencing Primer
(F):5'- AGAATCCTTGGTAAAATTGTAGCTC -3'
(R):5'- GTCTTCAATAACTCAAATAGCAC -3'

Posted On

2015-02-18