Incidental Mutation 'R3422:Mgat4d'
ID267084
Institutional Source Beutler Lab
Gene Symbol Mgat4d
Ensembl Gene ENSMUSG00000035057
Gene NameMGAT4 family, member C
Synonyms4933434I20Rik
MMRRC Submission 040640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3422 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83348471-83382320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83358143 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 172 (S172P)
Ref Sequence ENSEMBL: ENSMUSP00000041629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038692]
Predicted Effect probably damaging
Transcript: ENSMUST00000038692
AA Change: S172P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041629
Gene: ENSMUSG00000035057
AA Change: S172P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_54 70 373 5.9e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139692
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Ahnak A G 19: 9,005,708 D1452G probably benign Het
Ahnak A G 19: 9,006,752 D1800G probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brca2 A G 5: 150,543,121 T2117A possibly damaging Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Ifit1bl1 T G 19: 34,593,950 N369T probably benign Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Me2 C T 18: 73,791,194 A316T probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmt2 A G 2: 3,284,388 E31G possibly damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Nwd2 G T 5: 63,725,193 V63L possibly damaging Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Otub1 C T 19: 7,199,059 D237N probably damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Soat2 T C 15: 102,156,809 probably benign Het
Spink5 A G 18: 44,010,244 K756R probably benign Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Vsig2 G A 9: 37,541,479 V195I possibly damaging Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp91 G A 19: 12,770,292 A489V probably benign Het
Other mutations in Mgat4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Mgat4d APN 8 83354796 missense probably benign 0.21
IGL01634:Mgat4d APN 8 83368116 missense possibly damaging 0.71
IGL01987:Mgat4d APN 8 83368102 missense probably damaging 1.00
IGL02084:Mgat4d APN 8 83368981 missense possibly damaging 0.72
R0546:Mgat4d UTSW 8 83355721 missense possibly damaging 0.94
R1322:Mgat4d UTSW 8 83365725 missense possibly damaging 0.74
R1526:Mgat4d UTSW 8 83369037 missense probably benign 0.25
R1617:Mgat4d UTSW 8 83365711 missense probably damaging 1.00
R2223:Mgat4d UTSW 8 83355672 splice site probably benign
R3157:Mgat4d UTSW 8 83354821 missense probably benign
R3421:Mgat4d UTSW 8 83358143 missense probably damaging 1.00
R4387:Mgat4d UTSW 8 83371706 missense probably damaging 1.00
R4796:Mgat4d UTSW 8 83358120 missense probably damaging 1.00
R4805:Mgat4d UTSW 8 83358158 splice site probably null
R5054:Mgat4d UTSW 8 83368208 splice site probably null
R6366:Mgat4d UTSW 8 83368951 splice site probably null
R6927:Mgat4d UTSW 8 83354867 missense probably benign 0.03
R7053:Mgat4d UTSW 8 83371632 missense probably damaging 0.98
R7554:Mgat4d UTSW 8 83355773 missense probably benign 0.00
R7566:Mgat4d UTSW 8 83358023 missense probably damaging 1.00
R8111:Mgat4d UTSW 8 83368147 missense probably damaging 0.96
Z1176:Mgat4d UTSW 8 83348521 missense probably benign 0.04
Z1176:Mgat4d UTSW 8 83368112 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGCCCACGGTAAACACTTG -3'
(R):5'- ACAATCTGATGGCTCTCCTATAAG -3'

Sequencing Primer
(F):5'- AACACTTGTTTACCGATGGCTTG -3'
(R):5'- CTGATGGCTCTCCTATAAGATTCATG -3'
Posted On2015-02-18