Incidental Mutation 'R3422:Olfr20'
ID267090
Institutional Source Beutler Lab
Gene Symbol Olfr20
Ensembl Gene ENSMUSG00000062128
Gene Nameolfactory receptor 20
SynonymsOlfr21, MOR135-11, MTPCR55, MTPCR06, GA_x6K02T2P1NL-3514066-3515010
MMRRC Submission 040640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R3422 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73350783-73355951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73354634 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 294 (N294D)
Ref Sequence ENSEMBL: ENSMUSP00000114110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108465] [ENSMUST00000117445] [ENSMUST00000120137]
Predicted Effect probably damaging
Transcript: ENSMUST00000108465
AA Change: N294D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104105
Gene: ENSMUSG00000062128
AA Change: N294D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.9e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.8e-8 PFAM
Pfam:7tm_1 41 290 1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117445
Predicted Effect probably damaging
Transcript: ENSMUST00000120137
AA Change: N294D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114110
Gene: ENSMUSG00000062128
AA Change: N294D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.5e-6 PFAM
Pfam:7tm_1 41 290 2.2e-26 PFAM
Meta Mutation Damage Score 0.4186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Ahnak A G 19: 9,005,708 D1452G probably benign Het
Ahnak A G 19: 9,006,752 D1800G probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brca2 A G 5: 150,543,121 T2117A possibly damaging Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Ifit1bl1 T G 19: 34,593,950 N369T probably benign Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Me2 C T 18: 73,791,194 A316T probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmt2 A G 2: 3,284,388 E31G possibly damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Nwd2 G T 5: 63,725,193 V63L possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Otub1 C T 19: 7,199,059 D237N probably damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Soat2 T C 15: 102,156,809 probably benign Het
Spink5 A G 18: 44,010,244 K756R probably benign Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Vsig2 G A 9: 37,541,479 V195I possibly damaging Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp91 G A 19: 12,770,292 A489V probably benign Het
Other mutations in Olfr20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Olfr20 APN 11 73354043 missense probably damaging 1.00
IGL02163:Olfr20 APN 11 73354494 missense probably damaging 1.00
R0598:Olfr20 UTSW 11 73353903 missense probably benign
R1348:Olfr20 UTSW 11 73353856 missense probably benign 0.02
R2006:Olfr20 UTSW 11 73354692 missense probably benign
R2085:Olfr20 UTSW 11 73354421 missense possibly damaging 0.95
R2263:Olfr20 UTSW 11 73354305 missense possibly damaging 0.89
R3421:Olfr20 UTSW 11 73354634 missense probably damaging 1.00
R4229:Olfr20 UTSW 11 73354232 missense probably damaging 1.00
R4749:Olfr20 UTSW 11 73354496 missense probably damaging 1.00
R5410:Olfr20 UTSW 11 73353806 missense probably benign 0.11
R6035:Olfr20 UTSW 11 73353756 start codon destroyed probably null 1.00
R6035:Olfr20 UTSW 11 73353756 start codon destroyed probably null 1.00
R6499:Olfr20 UTSW 11 73354185 missense probably damaging 1.00
R7840:Olfr20 UTSW 11 73353759 missense probably benign
R7959:Olfr20 UTSW 11 73353918 missense probably damaging 1.00
R8186:Olfr20 UTSW 11 73354421 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGGCATCCGTAAAGCCTTCTC -3'
(R):5'- ACCAAATAGACATTCCTACTTCTGC -3'

Sequencing Primer
(F):5'- GTAAAGCCTTCTCCACCTGTG -3'
(R):5'- TCCCTAGTGAAAAAAAGAAGT -3'
Posted On2015-02-18