Incidental Mutation 'R3422:Armc4'
ID267096
Institutional Source Beutler Lab
Gene Symbol Armc4
Ensembl Gene ENSMUSG00000061802
Gene Namearmadillo repeat containing 4
Synonymsb2b643Clo, 4930463I21Rik, b2b227.1Clo
MMRRC Submission 040640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R3422 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location7088233-7297901 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 7223523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081275]
Predicted Effect probably benign
Transcript: ENSMUST00000081275
SMART Domains Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802

DomainStartEndE-ValueType
low complexity region 172 186 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
ARM 475 516 1.38e1 SMART
ARM 517 557 2.38e-2 SMART
ARM 558 613 3.97e0 SMART
ARM 614 654 2.59e-3 SMART
ARM 655 695 3.48e1 SMART
ARM 696 737 1.6e1 SMART
ARM 738 778 4.09e0 SMART
ARM 779 819 9.68e0 SMART
ARM 861 903 3.52e0 SMART
ARM 904 944 1.26e1 SMART
ARM 945 985 1.03e1 SMART
ARM 986 1026 1.13e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Ahnak A G 19: 9,005,708 D1452G probably benign Het
Ahnak A G 19: 9,006,752 D1800G probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brca2 A G 5: 150,543,121 T2117A possibly damaging Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Ifit1bl1 T G 19: 34,593,950 N369T probably benign Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Me2 C T 18: 73,791,194 A316T probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmt2 A G 2: 3,284,388 E31G possibly damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Nwd2 G T 5: 63,725,193 V63L possibly damaging Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Otub1 C T 19: 7,199,059 D237N probably damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Soat2 T C 15: 102,156,809 probably benign Het
Spink5 A G 18: 44,010,244 K756R probably benign Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Vsig2 G A 9: 37,541,479 V195I possibly damaging Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp91 G A 19: 12,770,292 A489V probably benign Het
Other mutations in Armc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Armc4 APN 18 7211504 missense probably damaging 0.96
IGL00822:Armc4 APN 18 7181817 missense probably damaging 1.00
IGL01345:Armc4 APN 18 7266947 missense probably benign 0.00
IGL01593:Armc4 APN 18 7127345 missense probably benign 0.00
IGL01645:Armc4 APN 18 7268491 missense probably benign 0.00
IGL01863:Armc4 APN 18 7222617 missense probably damaging 1.00
IGL01955:Armc4 APN 18 7127291 missense possibly damaging 0.89
IGL02013:Armc4 APN 18 7265157 splice site probably benign
IGL02142:Armc4 APN 18 7214601 missense probably damaging 1.00
IGL02399:Armc4 APN 18 7285719 missense probably benign
IGL02439:Armc4 APN 18 7268444 missense probably benign 0.04
IGL02452:Armc4 APN 18 7129461 missense probably damaging 1.00
IGL02632:Armc4 APN 18 7214727 splice site probably benign
IGL03344:Armc4 APN 18 7129434 nonsense probably null
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0365:Armc4 UTSW 18 7217800 missense probably benign 0.01
R0377:Armc4 UTSW 18 7127415 missense probably benign 0.04
R0466:Armc4 UTSW 18 7286758 missense probably benign 0.10
R0517:Armc4 UTSW 18 7223621 missense probably damaging 1.00
R0521:Armc4 UTSW 18 7222676 missense possibly damaging 0.64
R0841:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1435:Armc4 UTSW 18 7222646 missense probably benign 0.01
R1487:Armc4 UTSW 18 7273245 missense probably damaging 0.98
R1634:Armc4 UTSW 18 7286688 missense probably damaging 0.99
R1677:Armc4 UTSW 18 7222554 missense probably benign 0.01
R1778:Armc4 UTSW 18 7127388 missense probably damaging 1.00
R1792:Armc4 UTSW 18 7286743 missense probably benign 0.00
R1809:Armc4 UTSW 18 7211630 missense probably benign 0.08
R1842:Armc4 UTSW 18 7223551 missense probably benign 0.04
R2144:Armc4 UTSW 18 7127229 missense probably damaging 0.96
R2206:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2273:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2275:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2918:Armc4 UTSW 18 7222625 missense probably benign 0.04
R3421:Armc4 UTSW 18 7223523 splice site probably benign
R4165:Armc4 UTSW 18 7217008 missense probably damaging 1.00
R4225:Armc4 UTSW 18 7181732 critical splice donor site probably null
R4660:Armc4 UTSW 18 7211609 missense possibly damaging 0.88
R4745:Armc4 UTSW 18 7286763 missense probably benign 0.28
R4812:Armc4 UTSW 18 7288634 missense possibly damaging 0.79
R4831:Armc4 UTSW 18 7222564 missense possibly damaging 0.79
R4923:Armc4 UTSW 18 7181787 missense probably damaging 0.97
R4995:Armc4 UTSW 18 7223663 missense probably damaging 1.00
R5024:Armc4 UTSW 18 7088555 missense probably benign 0.02
R5335:Armc4 UTSW 18 7294566 missense probably benign 0.06
R5434:Armc4 UTSW 18 7222550 missense probably benign 0.03
R5552:Armc4 UTSW 18 7285360 missense possibly damaging 0.51
R5719:Armc4 UTSW 18 7211496 missense probably benign 0.00
R5736:Armc4 UTSW 18 7268416 missense probably benign 0.01
R5792:Armc4 UTSW 18 7217965 missense probably benign 0.00
R5848:Armc4 UTSW 18 7268507 splice site probably null
R5957:Armc4 UTSW 18 7285706 missense probably benign 0.01
R6001:Armc4 UTSW 18 7286838 missense probably benign 0.03
R6309:Armc4 UTSW 18 7214617 missense probably benign 0.04
R6559:Armc4 UTSW 18 7223664 missense probably damaging 0.99
R6574:Armc4 UTSW 18 7129394 splice site probably null
R6581:Armc4 UTSW 18 7129560 missense possibly damaging 0.77
R6736:Armc4 UTSW 18 7223586 missense probably damaging 0.98
R6842:Armc4 UTSW 18 7268401 missense probably benign 0.00
R6968:Armc4 UTSW 18 7273155 splice site probably null
R6974:Armc4 UTSW 18 7294479 missense probably benign 0.37
R7024:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7299:Armc4 UTSW 18 7222635 missense probably damaging 1.00
R7578:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7737:Armc4 UTSW 18 7217890 missense probably damaging 1.00
R7878:Armc4 UTSW 18 7217801 missense probably benign 0.01
R8025:Armc4 UTSW 18 7127224 missense probably benign 0.43
R8151:Armc4 UTSW 18 7127358 missense probably damaging 1.00
Z1088:Armc4 UTSW 18 7266919 missense probably benign
Z1176:Armc4 UTSW 18 7129487 missense probably damaging 1.00
Z1176:Armc4 UTSW 18 7216973 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTTCCATCCCTGAAGATTACACAC -3'
(R):5'- TAGCTTGCAGAGAATGTGGCC -3'

Sequencing Primer
(F):5'- CTGAAGATTACACACAGCCTTTATAC -3'
(R):5'- GCAGAGAATGTGGCCTTATTTAACC -3'
Posted On2015-02-18