Incidental Mutation 'R3422:Me2'
ID267098
Institutional Source Beutler Lab
Gene Symbol Me2
Ensembl Gene ENSMUSG00000024556
Gene Namemalic enzyme 2, NAD(+)-dependent, mitochondrial
SynonymsD030040L20Rik
MMRRC Submission 040640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3422 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location73770040-73815392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73791194 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 316 (A316T)
Ref Sequence ENSEMBL: ENSMUSP00000025439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025439]
Predicted Effect probably damaging
Transcript: ENSMUST00000025439
AA Change: A316T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025439
Gene: ENSMUSG00000024556
AA Change: A316T

DomainStartEndE-ValueType
malic 89 270 3.48e-98 SMART
Malic_M 280 535 2.21e-103 SMART
Meta Mutation Damage Score 0.7325 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial NAD-dependent malic enzyme, a homotetrameric protein, that catalyzes the oxidative decarboxylation of malate to pyruvate. It had previously been weakly linked to a syndrome known as Friedreich ataxia that has since been shown to be the result of mutation in a completely different gene. Certain single-nucleotide polymorphism haplotypes of this gene have been shown to increase the risk for idiopathic generalized epilepsy. Alternatively spliced transcript variants encoding different isoforms found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Ahnak A G 19: 9,005,708 D1452G probably benign Het
Ahnak A G 19: 9,006,752 D1800G probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brca2 A G 5: 150,543,121 T2117A possibly damaging Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Ifit1bl1 T G 19: 34,593,950 N369T probably benign Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmt2 A G 2: 3,284,388 E31G possibly damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Nwd2 G T 5: 63,725,193 V63L possibly damaging Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Otub1 C T 19: 7,199,059 D237N probably damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Soat2 T C 15: 102,156,809 probably benign Het
Spink5 A G 18: 44,010,244 K756R probably benign Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Vsig2 G A 9: 37,541,479 V195I possibly damaging Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp91 G A 19: 12,770,292 A489V probably benign Het
Other mutations in Me2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Me2 APN 18 73770642 missense probably benign 0.01
IGL00977:Me2 APN 18 73791177 missense probably benign 0.24
IGL01161:Me2 APN 18 73770816 splice site probably benign
IGL02351:Me2 APN 18 73797967 missense probably benign 0.20
IGL02358:Me2 APN 18 73797967 missense probably benign 0.20
IGL02647:Me2 APN 18 73797903 missense probably benign 0.00
IGL03172:Me2 APN 18 73770726 missense probably benign
baako UTSW 18 73797945 missense probably damaging 1.00
excavator UTSW 18 73781058 missense probably damaging 1.00
first_born UTSW 18 73791128 nonsense probably null
muster UTSW 18 73791844 missense probably benign 0.01
roundup UTSW 18 73770673 missense probably benign
R0018:Me2 UTSW 18 73791852 missense possibly damaging 0.93
R0018:Me2 UTSW 18 73791852 missense possibly damaging 0.93
R0032:Me2 UTSW 18 73794525 missense probably benign
R0119:Me2 UTSW 18 73770673 missense probably benign
R0136:Me2 UTSW 18 73770673 missense probably benign
R0299:Me2 UTSW 18 73770673 missense probably benign
R0657:Me2 UTSW 18 73770673 missense probably benign
R1597:Me2 UTSW 18 73797945 missense probably damaging 1.00
R1638:Me2 UTSW 18 73773134 missense probably benign 0.03
R1765:Me2 UTSW 18 73791858 missense probably damaging 1.00
R1861:Me2 UTSW 18 73785714 missense probably benign 0.11
R2410:Me2 UTSW 18 73791112 missense probably damaging 0.98
R3954:Me2 UTSW 18 73781132 missense probably damaging 1.00
R3957:Me2 UTSW 18 73781132 missense probably damaging 1.00
R4052:Me2 UTSW 18 73791085 missense probably benign 0.05
R4207:Me2 UTSW 18 73791085 missense probably benign 0.05
R4208:Me2 UTSW 18 73791085 missense probably benign 0.05
R4694:Me2 UTSW 18 73801859 missense probably benign 0.01
R4962:Me2 UTSW 18 73785776 missense probably damaging 1.00
R5527:Me2 UTSW 18 73791116 missense probably damaging 1.00
R6170:Me2 UTSW 18 73785781 missense probably benign 0.07
R6185:Me2 UTSW 18 73791128 nonsense probably null
R6305:Me2 UTSW 18 73791844 missense probably benign 0.01
R6462:Me2 UTSW 18 73775399 missense probably benign 0.17
R7015:Me2 UTSW 18 73781147 splice site probably null
R7085:Me2 UTSW 18 73781058 missense probably damaging 1.00
R7096:Me2 UTSW 18 73794890 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGCTGTCAATGCCCAACTC -3'
(R):5'- TATTTCTTGGAGCAGGAGAAGTAAG -3'

Sequencing Primer
(F):5'- TGTCAATGCCCAACTCCAACAC -3'
(R):5'- CCTGGACTACATAGTGAGTTCCAG -3'
Posted On2015-02-18