Incidental Mutation 'R3422:Zfp91'
ID267102
Institutional Source Beutler Lab
Gene Symbol Zfp91
Ensembl Gene ENSMUSG00000024695
Gene Namezinc finger protein 91
SynonymsPzf, 9130014I08Rik, A530054C17Rik
MMRRC Submission 040640-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R3422 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12763660-12796126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12770292 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 489 (A489V)
Ref Sequence ENSEMBL: ENSMUSP00000124424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038627] [ENSMUST00000112933] [ENSMUST00000142247]
Predicted Effect probably benign
Transcript: ENSMUST00000038627
AA Change: A489V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000037971
Gene: ENSMUSG00000024695
AA Change: A489V

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 43 N/A INTRINSIC
low complexity region 72 92 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 207 226 N/A INTRINSIC
coiled coil region 256 284 N/A INTRINSIC
ZnF_C2H2 313 338 1.08e-1 SMART
ZnF_C2H2 344 368 7.15e-2 SMART
ZnF_C2H2 374 396 1.56e-2 SMART
ZnF_C2H2 402 424 2.61e-4 SMART
ZnF_C2H2 432 455 1.92e-2 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112933
SMART Domains Protein: ENSMUSP00000108555
Gene: ENSMUSG00000079415

DomainStartEndE-ValueType
Pfam:CNTF 1 194 4.2e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137256
Predicted Effect probably benign
Transcript: ENSMUST00000142247
AA Change: A489V

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124424
Gene: ENSMUSG00000024695
AA Change: A489V

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 43 N/A INTRINSIC
low complexity region 72 92 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 207 226 N/A INTRINSIC
coiled coil region 256 284 N/A INTRINSIC
ZnF_C2H2 313 338 1.08e-1 SMART
ZnF_C2H2 344 368 7.15e-2 SMART
ZnF_C2H2 374 396 1.56e-2 SMART
ZnF_C2H2 402 424 2.61e-4 SMART
ZnF_C2H2 432 455 1.92e-2 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the zinc finger family of proteins. The gene product contains C2H2-type domains, which are the classical zinc finger domains found in numerous nucleic acid-binding proteins. The homologous human protein has been shown to function as a regulator of the non-canonical NF-kappaB pathway in lymphotoxin-beta receptor signaling. A read-through transcript variant composed of Zfp91 and the downstream Cntf gene sequence has been identified, but it is thought to be non-coding. Read-through transcription of Zfp91 and Cntf has been observed in both human and mouse. A Zfp91-related pseudogene has also been identified on chromosome 17. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Ahnak A G 19: 9,005,708 D1452G probably benign Het
Ahnak A G 19: 9,006,752 D1800G probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brca2 A G 5: 150,543,121 T2117A possibly damaging Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Ifit1bl1 T G 19: 34,593,950 N369T probably benign Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Me2 C T 18: 73,791,194 A316T probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmt2 A G 2: 3,284,388 E31G possibly damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Nwd2 G T 5: 63,725,193 V63L possibly damaging Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Otub1 C T 19: 7,199,059 D237N probably damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Soat2 T C 15: 102,156,809 probably benign Het
Spink5 A G 18: 44,010,244 K756R probably benign Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Vsig2 G A 9: 37,541,479 V195I possibly damaging Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Other mutations in Zfp91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02240:Zfp91 APN 19 12776406 splice site probably benign
R0139:Zfp91 UTSW 19 12770470 missense probably damaging 1.00
R0369:Zfp91 UTSW 19 12770074 missense possibly damaging 0.95
R0485:Zfp91 UTSW 19 12775989 splice site probably benign
R0559:Zfp91 UTSW 19 12770055 missense probably damaging 1.00
R0597:Zfp91 UTSW 19 12770095 missense possibly damaging 0.53
R1565:Zfp91 UTSW 19 12779075 missense probably benign 0.02
R4438:Zfp91 UTSW 19 12778021 nonsense probably null
R4898:Zfp91 UTSW 19 12770060 missense probably damaging 1.00
R4927:Zfp91 UTSW 19 12776410 critical splice donor site probably null
R5509:Zfp91 UTSW 19 12779087 missense probably damaging 0.99
R5878:Zfp91 UTSW 19 12770320 missense possibly damaging 0.80
R5978:Zfp91 UTSW 19 12770151 missense probably benign 0.43
R7703:Zfp91 UTSW 19 12776877 missense probably benign 0.24
R7864:Zfp91 UTSW 19 12771039 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGAGTATATCCGAGTTCATGAC -3'
(R):5'- ATGATGCAGACTCCTTCTACCAG -3'

Sequencing Primer
(F):5'- GAGTATATCCGAGTTCATGACCAGCC -3'
(R):5'- ACCAGTTTTCTTGCAATATCTGTGG -3'
Posted On2015-02-18