Incidental Mutation 'R3422:Slc7a3'
ID267103
Institutional Source Beutler Lab
Gene Symbol Slc7a3
Ensembl Gene ENSMUSG00000031297
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 3
SynonymsSLC7A2, SLC7A1, Cat3, Atrc3
MMRRC Submission 040640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R3422 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location101079210-101086020 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 101080875 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073927] [ENSMUST00000101362] [ENSMUST00000113710]
Predicted Effect probably benign
Transcript: ENSMUST00000073927
SMART Domains Protein: ENSMUSP00000073582
Gene: ENSMUSG00000031297

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 519 9.3e-52 PFAM
Pfam:AA_permease 36 441 5.8e-34 PFAM
Pfam:AA_permease_C 538 588 3.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101362
SMART Domains Protein: ENSMUSP00000098914
Gene: ENSMUSG00000031297

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 519 9.3e-52 PFAM
Pfam:AA_permease 36 441 5.8e-34 PFAM
Pfam:AA_permease_C 538 588 3.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113710
SMART Domains Protein: ENSMUSP00000109339
Gene: ENSMUSG00000031297

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 519 2.5e-51 PFAM
Pfam:AA_permease 36 441 3.2e-33 PFAM
Pfam:AA_permease_C 538 588 3.7e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151922
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the system y+ cationic amino acid transporter family. Proteins of this family allow uptake of arginine from extracellular media. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Ahnak A G 19: 9,005,708 D1452G probably benign Het
Ahnak A G 19: 9,006,752 D1800G probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brca2 A G 5: 150,543,121 T2117A possibly damaging Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Ifit1bl1 T G 19: 34,593,950 N369T probably benign Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Me2 C T 18: 73,791,194 A316T probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmt2 A G 2: 3,284,388 E31G possibly damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Nwd2 G T 5: 63,725,193 V63L possibly damaging Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Otub1 C T 19: 7,199,059 D237N probably damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Soat2 T C 15: 102,156,809 probably benign Het
Spink5 A G 18: 44,010,244 K756R probably benign Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Vsig2 G A 9: 37,541,479 V195I possibly damaging Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp91 G A 19: 12,770,292 A489V probably benign Het
Other mutations in Slc7a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Slc7a3 APN X 101079492 missense probably benign 0.01
IGL02510:Slc7a3 APN X 101082833 missense probably benign 0.03
R2059:Slc7a3 UTSW X 101080767 missense probably benign
R3421:Slc7a3 UTSW X 101080875 splice site probably benign
Predicted Primers PCR Primer
(F):5'- CACCAAGCAGTGAGGAGCAA -3'
(R):5'- TTGCATATCCAGGTAGATACATGT -3'

Sequencing Primer
(F):5'- TGAGGAGCAAACATAGACAACTC -3'
(R):5'- AATCCCCTGAAGCTAGTTATGGG -3'
Posted On2015-02-18