Incidental Mutation 'R3423:Spg11'
ID267107
Institutional Source Beutler Lab
Gene Symbol Spg11
Ensembl Gene ENSMUSG00000033396
Gene NameSPG11, spatacsin vesicle trafficking associated
SynonymsC530005A01Rik, 6030465E24Rik
MMRRC Submission 040641-MU
Accession Numbers

Genbank: NM_145531

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R3423 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122053520-122118386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122071053 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1469 (V1469I)
Ref Sequence ENSEMBL: ENSMUSP00000037543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036450]
Predicted Effect probably benign
Transcript: ENSMUST00000036450
AA Change: V1469I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: V1469I

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 254 276 N/A INTRINSIC
low complexity region 945 958 N/A INTRINSIC
low complexity region 1250 1264 N/A INTRINSIC
low complexity region 1305 1313 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
low complexity region 1772 1784 N/A INTRINSIC
Pfam:Spatacsin_C 2082 2374 1.1e-105 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8 A G 17: 32,316,455 F195S possibly damaging Het
Aldh3a1 G A 11: 61,215,536 A246T probably damaging Het
Caskin1 T A 17: 24,499,565 N331K probably damaging Het
Ceacam5 G A 7: 17,757,637 S644N possibly damaging Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp4a12a A C 4: 115,327,274 K282T probably benign Het
Dtnb C T 12: 3,591,962 R42* probably null Het
Dyrk3 A G 1: 131,129,482 I318T probably damaging Het
Fam160b2 G A 14: 70,586,585 T535M probably damaging Het
Gm11110 T C 17: 57,103,435 probably benign Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
Igfn1 A G 1: 135,998,641 S24P probably benign Het
Inpp4b A G 8: 81,952,261 M307V possibly damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kmt2a A C 9: 44,820,097 probably benign Het
Limk1 A G 5: 134,672,669 probably null Het
Lrrc14 T A 15: 76,713,118 probably null Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mug2 T C 6: 122,047,506 probably benign Het
Myo15 G A 11: 60,510,300 probably null Het
Nup98 T C 7: 102,184,877 T293A probably benign Het
Nwd2 A T 5: 63,800,161 Y278F probably damaging Het
Olfr101 T A 17: 37,299,870 D184V probably benign Het
Phactr4 A C 4: 132,369,747 D496E probably benign Het
Pramel6 T A 2: 87,510,796 probably null Het
Ptprq C T 10: 107,582,476 A1680T probably damaging Het
Retnlb T A 16: 48,818,645 C70S probably damaging Het
Ros1 C A 10: 52,128,416 probably null Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Sos2 T C 12: 69,603,553 N865D probably damaging Het
Sp9 G A 2: 73,273,971 A290T probably benign Het
Unc13c G T 9: 73,930,653 A972D possibly damaging Het
Vwa3a T C 7: 120,799,111 L945P probably damaging Het
Other mutations in Spg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Spg11 APN 2 122065560 missense probably damaging 0.96
IGL00495:Spg11 APN 2 122094456 critical splice donor site probably null
IGL00757:Spg11 APN 2 122070959 missense probably benign 0.05
IGL01304:Spg11 APN 2 122072290 missense probably damaging 1.00
IGL01355:Spg11 APN 2 122113156 missense probably benign
IGL01626:Spg11 APN 2 122060971 missense probably damaging 0.98
IGL01739:Spg11 APN 2 122114671 missense probably damaging 1.00
IGL01835:Spg11 APN 2 122088224 missense probably benign 0.36
IGL02129:Spg11 APN 2 122095686 missense probably damaging 0.99
IGL02178:Spg11 APN 2 122097302 missense probably damaging 1.00
IGL02199:Spg11 APN 2 122059553 missense probably damaging 1.00
IGL02212:Spg11 APN 2 122108157 missense probably benign 0.31
IGL02605:Spg11 APN 2 122092260 missense probably benign 0.00
IGL02635:Spg11 APN 2 122113068 missense possibly damaging 0.52
IGL02743:Spg11 APN 2 122059507 missense probably damaging 0.97
IGL02822:Spg11 APN 2 122074534 missense probably damaging 0.99
IGL02992:Spg11 APN 2 122058398 missense probably damaging 1.00
IGL03010:Spg11 APN 2 122088320 missense probably damaging 0.96
3-1:Spg11 UTSW 2 122086890 missense probably damaging 0.98
PIT4354001:Spg11 UTSW 2 122088185 missense probably damaging 0.98
R0131:Spg11 UTSW 2 122070968 missense probably damaging 1.00
R0206:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0208:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0302:Spg11 UTSW 2 122092187 missense possibly damaging 0.90
R0347:Spg11 UTSW 2 122097369 missense probably damaging 0.99
R0357:Spg11 UTSW 2 122066232 splice site probably benign
R0372:Spg11 UTSW 2 122059447 frame shift probably null
R0715:Spg11 UTSW 2 122084983 missense probably benign 0.03
R0927:Spg11 UTSW 2 122094487 missense probably damaging 0.99
R1163:Spg11 UTSW 2 122070941 missense probably damaging 1.00
R1534:Spg11 UTSW 2 122092325 missense probably damaging 1.00
R1555:Spg11 UTSW 2 122097377 missense probably damaging 0.99
R1569:Spg11 UTSW 2 122101706 missense probably damaging 0.99
R1840:Spg11 UTSW 2 122101756 missense probably damaging 1.00
R1929:Spg11 UTSW 2 122060207 missense probably damaging 1.00
R2265:Spg11 UTSW 2 122108307 missense possibly damaging 0.48
R2303:Spg11 UTSW 2 122068837 missense probably damaging 0.99
R2510:Spg11 UTSW 2 122075310 missense probably benign 0.03
R2760:Spg11 UTSW 2 122097359 missense probably damaging 0.99
R2918:Spg11 UTSW 2 122075301 missense probably damaging 0.99
R3195:Spg11 UTSW 2 122083398 critical splice donor site probably null
R4353:Spg11 UTSW 2 122113194 missense possibly damaging 0.92
R4407:Spg11 UTSW 2 122075332 missense probably benign 0.00
R4644:Spg11 UTSW 2 122061029 missense probably benign 0.03
R4663:Spg11 UTSW 2 122098099 critical splice donor site probably null
R4684:Spg11 UTSW 2 122065076 missense probably damaging 1.00
R4771:Spg11 UTSW 2 122065482 nonsense probably null
R4810:Spg11 UTSW 2 122059796 missense probably damaging 1.00
R4829:Spg11 UTSW 2 122108455 missense probably benign 0.44
R5089:Spg11 UTSW 2 122114717 nonsense probably null
R5362:Spg11 UTSW 2 122061000 missense probably damaging 0.99
R5684:Spg11 UTSW 2 122093503 missense probably damaging 1.00
R5899:Spg11 UTSW 2 122098199 missense possibly damaging 0.67
R5923:Spg11 UTSW 2 122093478 missense probably damaging 0.98
R6052:Spg11 UTSW 2 122097356 missense probably damaging 0.99
R6111:Spg11 UTSW 2 122093482 missense probably damaging 0.98
R6174:Spg11 UTSW 2 122086805 intron probably null
R6226:Spg11 UTSW 2 122088262 missense possibly damaging 0.69
R6336:Spg11 UTSW 2 122112959 unclassified probably null
R6480:Spg11 UTSW 2 122092305 missense probably benign 0.03
R6494:Spg11 UTSW 2 122113225 missense probably damaging 0.98
R6582:Spg11 UTSW 2 122092292 missense probably damaging 0.99
R6714:Spg11 UTSW 2 122095731 missense probably damaging 0.99
R6791:Spg11 UTSW 2 122093443 missense probably damaging 0.99
R6836:Spg11 UTSW 2 122059535 missense probably damaging 1.00
R6928:Spg11 UTSW 2 122069904 missense probably benign 0.37
R7179:Spg11 UTSW 2 122101789 splice site probably null
R7229:Spg11 UTSW 2 122108104 missense probably damaging 0.98
R7337:Spg11 UTSW 2 122084993 missense probably benign 0.09
R7338:Spg11 UTSW 2 122055377 missense probably damaging 1.00
R7351:Spg11 UTSW 2 122069931 missense possibly damaging 0.95
R7378:Spg11 UTSW 2 122058429 missense probably damaging 1.00
R7448:Spg11 UTSW 2 122093545 critical splice acceptor site probably null
R7505:Spg11 UTSW 2 122075351 nonsense probably null
R7665:Spg11 UTSW 2 122066267 missense probably damaging 0.99
R7685:Spg11 UTSW 2 122068880 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCTCGGATGAGAGTGTGG -3'
(R):5'- CATTAAGCTGTCTCCTGGCACC -3'

Sequencing Primer
(F):5'- GGCTCTTGCGTCTTGTCAATACAG -3'
(R):5'- TGTCTCCTGGCACCAGTGAAG -3'
Posted On2015-02-18