Mutagenetix > Incidental Mutation

Incidental Mutation 'R3423:Nup98'

267115

Institutional Source

Beutler Lab

Gene Symbol

Nup98

Ensembl Gene

ENSMUSG00000063550

Gene Name

nucleoporin 98

Synonyms

Nup96

MMRRC Submission

040641-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3423 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101768607-101859359 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101834084 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 293 (T293A)

Ref Sequence

ENSEMBL: ENSMUSP00000147454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070165
AA Change: T293A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: T293A

Domain	Start	End	E-Value	Type
Pfam:Nucleoporin_FG	3	88	4.6e-4	PFAM
Pfam:Nucleoporin_FG	69	170	3.4e-6	PFAM
Pfam:Nucleoporin_FG	210	307	6.1e-5	PFAM
Pfam:Nucleoporin_FG	246	332	2.2e-7	PFAM
Pfam:Nucleoporin_FG	266	359	1.2e-7	PFAM
Pfam:Nucleoporin_FG	309	425	1.8e-2	PFAM
Pfam:Nucleoporin_FG	398	497	2.2e-2	PFAM
low complexity region	594	610	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
Pfam:Nucleoporin2	740	880	5.4e-45	PFAM
PDB:1KO6\|D	881	925	1e-16	PDB
low complexity region	926	935	N/A	INTRINSIC
low complexity region	1033	1042	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209242

Predicted Effect

probably benign
Transcript: ENSMUST00000210682
AA Change: T293A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000211005
AA Change: T293A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000211022
AA Change: T293A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000211235
AA Change: T293A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

probably benign
Transcript: ENSMUST00000211764

Meta Mutation Damage Score

0.0725

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap8	A	G	17: 32,535,429 (GRCm39)	F195S	possibly damaging	Het
Aldh3a1	G	A	11: 61,106,362 (GRCm39)	A246T	probably damaging	Het
Caskin1	T	A	17: 24,718,539 (GRCm39)	N331K	probably damaging	Het
Ceacam5	G	A	7: 17,491,562 (GRCm39)	S644N	possibly damaging	Het
Csmd3	A	T	15: 47,710,648 (GRCm39)	D1646E	probably damaging	Het
Cyp4a12a	A	C	4: 115,184,471 (GRCm39)	K282T	probably benign	Het
Dtnb	C	T	12: 3,641,962 (GRCm39)	R42*	probably null	Het
Dyrk3	A	G	1: 131,057,219 (GRCm39)	I318T	probably damaging	Het
Fhip2b	G	A	14: 70,824,025 (GRCm39)	T535M	probably damaging	Het
Gm11110	T	C	17: 57,410,435 (GRCm39)		probably benign	Het
Gm8674	T	A	13: 50,055,792 (GRCm39)		noncoding transcript	Het
Igfn1	A	G	1: 135,926,379 (GRCm39)	S24P	probably benign	Het
Inpp4b	A	G	8: 82,678,890 (GRCm39)	M307V	possibly damaging	Het
Ism2	T	C	12: 87,333,871 (GRCm39)	N58S	probably benign	Het
Kmt2a	A	C	9: 44,731,394 (GRCm39)		probably benign	Het
Limk1	A	G	5: 134,701,523 (GRCm39)		probably null	Het
Lrrc14	T	A	15: 76,597,318 (GRCm39)		probably null	Het
Mapt	C	T	11: 104,189,548 (GRCm39)	R189*	probably null	Het
Meltf	C	T	16: 31,715,343 (GRCm39)	R679*	probably null	Het
Muc6	G	A	7: 141,218,313 (GRCm39)	S2120F	possibly damaging	Het
Mug2	T	C	6: 122,024,465 (GRCm39)		probably benign	Het
Myo15a	G	A	11: 60,401,126 (GRCm39)		probably null	Het
Nwd2	A	T	5: 63,957,504 (GRCm39)	Y278F	probably damaging	Het
Or12d12	T	A	17: 37,610,761 (GRCm39)	D184V	probably benign	Het
Phactr4	A	C	4: 132,097,058 (GRCm39)	D496E	probably benign	Het
Pramel6	T	A	2: 87,341,140 (GRCm39)		probably null	Het
Ptprq	C	T	10: 107,418,337 (GRCm39)	A1680T	probably damaging	Het
Retnlb	T	A	16: 48,639,008 (GRCm39)	C70S	probably damaging	Het
Ros1	C	A	10: 52,004,512 (GRCm39)		probably null	Het
Sez6l	T	C	5: 112,574,615 (GRCm39)	D875G	probably damaging	Het
Slc18b1	T	G	10: 23,698,874 (GRCm39)	M348R	probably damaging	Het
Slc36a3	G	T	11: 55,033,607 (GRCm39)	T137K	probably benign	Het
Sos2	T	C	12: 69,650,327 (GRCm39)	N865D	probably damaging	Het
Sp9	G	A	2: 73,104,315 (GRCm39)	A290T	probably benign	Het
Spg11	C	T	2: 121,901,534 (GRCm39)	V1469I	probably benign	Het
Unc13c	G	T	9: 73,837,935 (GRCm39)	A972D	possibly damaging	Het
Vwa3a	T	C	7: 120,398,334 (GRCm39)	L945P	probably damaging	Het

Other mutations in Nup98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Nup98	APN	7	101,844,194 (GRCm39)	missense	probably damaging	1.00
IGL00789:Nup98	APN	7	101,803,178 (GRCm39)	missense	probably benign
IGL00798:Nup98	APN	7	101,796,411 (GRCm39)	missense	probably damaging	1.00
IGL01562:Nup98	APN	7	101,835,125 (GRCm39)	missense	probably damaging	0.99
IGL01942:Nup98	APN	7	101,843,918 (GRCm39)	missense	probably damaging	1.00
IGL02109:Nup98	APN	7	101,832,693 (GRCm39)	missense	probably benign	0.37
IGL02490:Nup98	APN	7	101,801,573 (GRCm39)	missense	probably damaging	1.00
IGL03184:Nup98	APN	7	101,832,752 (GRCm39)	missense	probably damaging	0.99
PIT4519001:Nup98	UTSW	7	101,784,171 (GRCm39)	missense	probably benign	0.00
R0040:Nup98	UTSW	7	101,841,241 (GRCm39)	missense	probably damaging	1.00
R0133:Nup98	UTSW	7	101,788,859 (GRCm39)	critical splice acceptor site	probably null
R0309:Nup98	UTSW	7	101,801,635 (GRCm39)	missense	probably null
R0471:Nup98	UTSW	7	101,788,004 (GRCm39)	missense	probably benign	0.13
R0538:Nup98	UTSW	7	101,835,892 (GRCm39)	missense	probably damaging	1.00
R0650:Nup98	UTSW	7	101,801,660 (GRCm39)	missense	probably damaging	1.00
R0730:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R0881:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R0900:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1120:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1159:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1469:Nup98	UTSW	7	101,788,008 (GRCm39)	missense	probably benign	0.00
R1469:Nup98	UTSW	7	101,788,008 (GRCm39)	missense	probably benign	0.00
R1470:Nup98	UTSW	7	101,796,513 (GRCm39)	missense	probably damaging	0.98
R1470:Nup98	UTSW	7	101,796,513 (GRCm39)	missense	probably damaging	0.98
R1545:Nup98	UTSW	7	101,784,087 (GRCm39)	missense	possibly damaging	0.77
R1775:Nup98	UTSW	7	101,784,144 (GRCm39)	missense	probably benign	0.03
R1889:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R2080:Nup98	UTSW	7	101,829,631 (GRCm39)	missense	probably damaging	0.96
R4361:Nup98	UTSW	7	101,794,921 (GRCm39)	missense	probably damaging	1.00
R4678:Nup98	UTSW	7	101,834,038 (GRCm39)	missense	probably damaging	1.00
R4864:Nup98	UTSW	7	101,802,403 (GRCm39)	missense	possibly damaging	0.94
R4910:Nup98	UTSW	7	101,845,007 (GRCm39)	missense	unknown
R4924:Nup98	UTSW	7	101,784,185 (GRCm39)	missense	probably damaging	1.00
R5068:Nup98	UTSW	7	101,794,862 (GRCm39)	missense	probably benign	0.00
R5069:Nup98	UTSW	7	101,794,862 (GRCm39)	missense	probably benign	0.00
R5233:Nup98	UTSW	7	101,845,029 (GRCm39)	missense	unknown
R5779:Nup98	UTSW	7	101,801,568 (GRCm39)	missense	probably benign
R5922:Nup98	UTSW	7	101,803,224 (GRCm39)	missense	probably damaging	1.00
R6010:Nup98	UTSW	7	101,829,636 (GRCm39)	missense	probably damaging	1.00
R6039:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R6039:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R6343:Nup98	UTSW	7	101,843,957 (GRCm39)	missense	possibly damaging	0.90
R6364:Nup98	UTSW	7	101,825,522 (GRCm39)	missense	probably damaging	1.00
R6462:Nup98	UTSW	7	101,844,223 (GRCm39)	missense	probably benign	0.03
R6577:Nup98	UTSW	7	101,778,053 (GRCm39)	splice site	probably null
R6900:Nup98	UTSW	7	101,835,169 (GRCm39)	missense	probably damaging	1.00
R7205:Nup98	UTSW	7	101,844,248 (GRCm39)	missense	unknown
R7218:Nup98	UTSW	7	101,841,107 (GRCm39)	splice site	probably null
R7235:Nup98	UTSW	7	101,774,491 (GRCm39)	missense	probably damaging	1.00
R7307:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R7402:Nup98	UTSW	7	101,784,144 (GRCm39)	missense	probably benign	0.00
R7427:Nup98	UTSW	7	101,784,208 (GRCm39)	splice site	probably null
R7428:Nup98	UTSW	7	101,784,208 (GRCm39)	splice site	probably null
R7584:Nup98	UTSW	7	101,825,596 (GRCm39)	missense	probably benign	0.02
R7646:Nup98	UTSW	7	101,803,242 (GRCm39)	missense	probably benign	0.01
R7648:Nup98	UTSW	7	101,773,404 (GRCm39)	missense	possibly damaging	0.94
R7742:Nup98	UTSW	7	101,802,464 (GRCm39)	splice site	probably null
R7827:Nup98	UTSW	7	101,773,569 (GRCm39)	missense	probably benign	0.10
R7884:Nup98	UTSW	7	101,825,556 (GRCm39)	missense	probably benign	0.12
R7943:Nup98	UTSW	7	101,844,029 (GRCm39)	missense	probably benign	0.10
R8034:Nup98	UTSW	7	101,794,930 (GRCm39)	critical splice acceptor site	probably null
R8952:Nup98	UTSW	7	101,835,859 (GRCm39)	missense	probably damaging	1.00
R9060:Nup98	UTSW	7	101,783,895 (GRCm39)	missense	probably damaging	1.00
R9099:Nup98	UTSW	7	101,844,173 (GRCm39)	missense	probably damaging	0.98
R9146:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9148:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9223:Nup98	UTSW	7	101,834,167 (GRCm39)	missense	possibly damaging	0.82
R9246:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9249:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9272:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9274:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9283:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9326:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9466:Nup98	UTSW	7	101,818,611 (GRCm39)	missense	probably benign	0.05
R9492:Nup98	UTSW	7	101,778,252 (GRCm39)	missense	probably benign	0.11
R9661:Nup98	UTSW	7	101,782,019 (GRCm39)	nonsense	probably null
T0970:Nup98	UTSW	7	101,835,959 (GRCm39)	unclassified	probably benign
X0054:Nup98	UTSW	7	101,796,415 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGGTCTGATACAAAATCCAGGTC -3'
(R):5'- CAGACGATTGTTGGCTCATTTG -3'

Sequencing Primer
(F):5'- CTCCATTCAAAAGAAATGCAGTAGAG -3'
(R):5'- GGCTCATTTGAGAGAATTTTTGGG -3'

Posted On

2015-02-18