Incidental Mutation 'R3423:Slc36a3'
ID267124
Institutional Source Beutler Lab
Gene Symbol Slc36a3
Ensembl Gene ENSMUSG00000049491
Gene Namesolute carrier family 36 (proton/amino acid symporter), member 3
SynonymsTRAMD2, tramdorin2, PAT3
MMRRC Submission 040641-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3423 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location55124815-55151708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55142781 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 137 (T137K)
Ref Sequence ENSEMBL: ENSMUSP00000020502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020502] [ENSMUST00000128244]
Predicted Effect probably benign
Transcript: ENSMUST00000020502
AA Change: T137K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020502
Gene: ENSMUSG00000049491
AA Change: T137K

DomainStartEndE-ValueType
low complexity region 19 44 N/A INTRINSIC
Pfam:Aa_trans 50 459 7.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128244
SMART Domains Protein: ENSMUSP00000116073
Gene: ENSMUSG00000049491

DomainStartEndE-ValueType
low complexity region 19 44 N/A INTRINSIC
Pfam:Aa_trans 50 87 2.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155883
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8 A G 17: 32,316,455 F195S possibly damaging Het
Aldh3a1 G A 11: 61,215,536 A246T probably damaging Het
Caskin1 T A 17: 24,499,565 N331K probably damaging Het
Ceacam5 G A 7: 17,757,637 S644N possibly damaging Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp4a12a A C 4: 115,327,274 K282T probably benign Het
Dtnb C T 12: 3,591,962 R42* probably null Het
Dyrk3 A G 1: 131,129,482 I318T probably damaging Het
Fam160b2 G A 14: 70,586,585 T535M probably damaging Het
Gm11110 T C 17: 57,103,435 probably benign Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
Igfn1 A G 1: 135,998,641 S24P probably benign Het
Inpp4b A G 8: 81,952,261 M307V possibly damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kmt2a A C 9: 44,820,097 probably benign Het
Limk1 A G 5: 134,672,669 probably null Het
Lrrc14 T A 15: 76,713,118 probably null Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mug2 T C 6: 122,047,506 probably benign Het
Myo15 G A 11: 60,510,300 probably null Het
Nup98 T C 7: 102,184,877 T293A probably benign Het
Nwd2 A T 5: 63,800,161 Y278F probably damaging Het
Olfr101 T A 17: 37,299,870 D184V probably benign Het
Phactr4 A C 4: 132,369,747 D496E probably benign Het
Pramel6 T A 2: 87,510,796 probably null Het
Ptprq C T 10: 107,582,476 A1680T probably damaging Het
Retnlb T A 16: 48,818,645 C70S probably damaging Het
Ros1 C A 10: 52,128,416 probably null Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Sos2 T C 12: 69,603,553 N865D probably damaging Het
Sp9 G A 2: 73,273,971 A290T probably benign Het
Spg11 C T 2: 122,071,053 V1469I probably benign Het
Unc13c G T 9: 73,930,653 A972D possibly damaging Het
Vwa3a T C 7: 120,799,111 L945P probably damaging Het
Other mutations in Slc36a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03104:Slc36a3 APN 11 55125120 missense probably damaging 1.00
IGL03241:Slc36a3 APN 11 55125108 missense possibly damaging 0.95
R0632:Slc36a3 UTSW 11 55125080 missense probably damaging 1.00
R1117:Slc36a3 UTSW 11 55146180 missense possibly damaging 0.78
R1549:Slc36a3 UTSW 11 55142770 missense probably damaging 1.00
R3425:Slc36a3 UTSW 11 55142781 missense probably benign 0.00
R3791:Slc36a3 UTSW 11 55125156 missense possibly damaging 0.95
R3980:Slc36a3 UTSW 11 55135383 missense probably benign
R4970:Slc36a3 UTSW 11 55148573 missense probably damaging 1.00
R4973:Slc36a3 UTSW 11 55146804 splice site probably benign
R4986:Slc36a3 UTSW 11 55146766 makesense probably null
R5112:Slc36a3 UTSW 11 55148573 missense probably damaging 1.00
R5399:Slc36a3 UTSW 11 55146180 missense possibly damaging 0.78
R5534:Slc36a3 UTSW 11 55142769 missense possibly damaging 0.83
R5580:Slc36a3 UTSW 11 55135453 missense probably benign 0.14
R5682:Slc36a3 UTSW 11 55125663 missense probably benign 0.00
R5779:Slc36a3 UTSW 11 55135268 nonsense probably null
R5841:Slc36a3 UTSW 11 55125721 nonsense probably null
R6228:Slc36a3 UTSW 11 55124951 missense probably benign 0.01
R6483:Slc36a3 UTSW 11 55135263 missense probably benign 0.01
R6908:Slc36a3 UTSW 11 55149886 intron probably benign
R6927:Slc36a3 UTSW 11 55129693 missense probably damaging 0.98
R7828:Slc36a3 UTSW 11 55151198 missense probably benign 0.00
R7995:Slc36a3 UTSW 11 55129669 missense probably benign 0.04
Z1177:Slc36a3 UTSW 11 55135452 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTGGGGAGATACTCTATCTTGC -3'
(R):5'- GGTGTCCTTATTAGAGAGTGCAC -3'

Sequencing Primer
(F):5'- CCTAGCGGAACTTGCAGTCATATG -3'
(R):5'- GTCCTTATTAGAGAGTGCACAGAAC -3'
Posted On2015-02-18