Incidental Mutation 'R3423:Mapt'
ID267127
Institutional Source Beutler Lab
Gene Symbol Mapt
Ensembl Gene ENSMUSG00000018411
Gene Namemicrotubule-associated protein tau
SynonymsMtapt, Tau
MMRRC Submission 040641-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3423 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104231390-104332090 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 104298722 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 189 (R189*)
Ref Sequence ENSEMBL: ENSMUSP00000102602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100347] [ENSMUST00000106988] [ENSMUST00000106989] [ENSMUST00000106992] [ENSMUST00000106993] [ENSMUST00000132245] [ENSMUST00000132977] [ENSMUST00000145227]
Predicted Effect probably benign
Transcript: ENSMUST00000100347
SMART Domains Protein: ENSMUSP00000097919
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 127 139 N/A INTRINSIC
low complexity region 163 212 N/A INTRINSIC
Pfam:Tubulin-binding 232 263 1.4e-18 PFAM
Pfam:Tubulin-binding 264 294 3.3e-21 PFAM
Pfam:Tubulin-binding 295 325 1.6e-19 PFAM
Pfam:Tubulin-binding 326 357 1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106988
AA Change: R173*
SMART Domains Protein: ENSMUSP00000102601
Gene: ENSMUSG00000018411
AA Change: R173*

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
low complexity region 466 515 N/A INTRINSIC
Pfam:Tubulin-binding 535 566 3.5e-19 PFAM
Pfam:Tubulin-binding 567 597 8.6e-22 PFAM
Pfam:Tubulin-binding 598 628 4e-20 PFAM
Pfam:Tubulin-binding 629 660 2.7e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106989
AA Change: R189*
SMART Domains Protein: ENSMUSP00000102602
Gene: ENSMUSG00000018411
AA Change: R189*

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 482 531 N/A INTRINSIC
Pfam:Tubulin-binding 552 582 1.7e-13 PFAM
Pfam:Tubulin-binding 583 613 6.8e-20 PFAM
Pfam:Tubulin-binding 614 644 2.3e-17 PFAM
Pfam:Tubulin-binding 645 676 3.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106992
SMART Domains Protein: ENSMUSP00000102605
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 105 154 N/A INTRINSIC
Pfam:Tubulin-binding 174 205 6.1e-19 PFAM
Pfam:Tubulin-binding 206 236 1.5e-21 PFAM
Pfam:Tubulin-binding 237 267 6.9e-20 PFAM
Pfam:Tubulin-binding 268 299 4.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106993
SMART Domains Protein: ENSMUSP00000102606
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 140 172 N/A INTRINSIC
Pfam:Tubulin-binding 192 223 4.6e-19 PFAM
Pfam:Tubulin-binding 224 254 1.1e-21 PFAM
Pfam:Tubulin-binding 255 285 5.3e-20 PFAM
Pfam:Tubulin-binding 286 317 3.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132245
Predicted Effect probably benign
Transcript: ENSMUST00000132977
SMART Domains Protein: ENSMUSP00000123260
Gene: ENSMUSG00000018411

DomainStartEndE-ValueType
low complexity region 76 88 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138384
Predicted Effect probably benign
Transcript: ENSMUST00000145227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146353
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit altered performance in behavioral tests and show mircotubule changes in small-calibre axons. Embryonic hippocampal cultures from mutants exhibit delayed axonal and neuritic maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8 A G 17: 32,316,455 F195S possibly damaging Het
Aldh3a1 G A 11: 61,215,536 A246T probably damaging Het
Caskin1 T A 17: 24,499,565 N331K probably damaging Het
Ceacam5 G A 7: 17,757,637 S644N possibly damaging Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp4a12a A C 4: 115,327,274 K282T probably benign Het
Dtnb C T 12: 3,591,962 R42* probably null Het
Dyrk3 A G 1: 131,129,482 I318T probably damaging Het
Fam160b2 G A 14: 70,586,585 T535M probably damaging Het
Gm11110 T C 17: 57,103,435 probably benign Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
Igfn1 A G 1: 135,998,641 S24P probably benign Het
Inpp4b A G 8: 81,952,261 M307V possibly damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kmt2a A C 9: 44,820,097 probably benign Het
Limk1 A G 5: 134,672,669 probably null Het
Lrrc14 T A 15: 76,713,118 probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mug2 T C 6: 122,047,506 probably benign Het
Myo15 G A 11: 60,510,300 probably null Het
Nup98 T C 7: 102,184,877 T293A probably benign Het
Nwd2 A T 5: 63,800,161 Y278F probably damaging Het
Olfr101 T A 17: 37,299,870 D184V probably benign Het
Phactr4 A C 4: 132,369,747 D496E probably benign Het
Pramel6 T A 2: 87,510,796 probably null Het
Ptprq C T 10: 107,582,476 A1680T probably damaging Het
Retnlb T A 16: 48,818,645 C70S probably damaging Het
Ros1 C A 10: 52,128,416 probably null Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Sos2 T C 12: 69,603,553 N865D probably damaging Het
Sp9 G A 2: 73,273,971 A290T probably benign Het
Spg11 C T 2: 122,071,053 V1469I probably benign Het
Unc13c G T 9: 73,930,653 A972D possibly damaging Het
Vwa3a T C 7: 120,799,111 L945P probably damaging Het
Other mutations in Mapt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Mapt APN 11 104322485 missense probably damaging 1.00
IGL00473:Mapt APN 11 104287183 missense probably damaging 1.00
IGL01599:Mapt APN 11 104294915 missense probably damaging 1.00
IGL01862:Mapt APN 11 104290002 intron probably benign
IGL02315:Mapt APN 11 104328078 missense probably damaging 0.99
IGL03369:Mapt APN 11 104282433 missense probably damaging 1.00
R0040:Mapt UTSW 11 104305398 missense probably damaging 0.97
R0040:Mapt UTSW 11 104305398 missense probably damaging 0.97
R1913:Mapt UTSW 11 104328075 missense probably damaging 1.00
R1918:Mapt UTSW 11 104298499 missense probably benign 0.26
R3425:Mapt UTSW 11 104298722 nonsense probably null
R3831:Mapt UTSW 11 104287135 missense possibly damaging 0.89
R3833:Mapt UTSW 11 104287135 missense possibly damaging 0.89
R4095:Mapt UTSW 11 104310536 critical splice donor site probably null
R4814:Mapt UTSW 11 104298960 missense probably benign 0.04
R4890:Mapt UTSW 11 104328149 missense probably damaging 1.00
R5613:Mapt UTSW 11 104302390 missense possibly damaging 0.82
R6415:Mapt UTSW 11 104298998 missense probably benign 0.01
R6956:Mapt UTSW 11 104318255 splice site probably null
R7395:Mapt UTSW 11 104328123 missense probably damaging 0.99
R7406:Mapt UTSW 11 104322524 missense possibly damaging 0.94
R7547:Mapt UTSW 11 104322312 intron probably null
R7554:Mapt UTSW 11 104298702 missense probably benign 0.09
R7555:Mapt UTSW 11 104298702 missense probably benign 0.09
R7556:Mapt UTSW 11 104298702 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTTGCTTGTCGAACCAGGGC -3'
(R):5'- CTGCGGAGACTTTGGAGAAG -3'

Sequencing Primer
(F):5'- ACCAGGGCGTCGTGAAG -3'
(R):5'- GGACGGAACCCTCAGTTG -3'
Posted On2015-02-18