Incidental Mutation 'R3423:Caskin1'
ID267138
Institutional Source Beutler Lab
Gene Symbol Caskin1
Ensembl Gene ENSMUSG00000033597
Gene NameCASK interacting protein 1
SynonymsC630036E02Rik, 3300002N10Rik
MMRRC Submission 040641-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R3423 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24488783-24508905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24499565 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 331 (N331K)
Ref Sequence ENSEMBL: ENSMUSP00000024958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958]
Predicted Effect probably damaging
Transcript: ENSMUST00000024958
AA Change: N331K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597
AA Change: N331K

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Meta Mutation Damage Score 0.1330 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8 A G 17: 32,316,455 F195S possibly damaging Het
Aldh3a1 G A 11: 61,215,536 A246T probably damaging Het
Ceacam5 G A 7: 17,757,637 S644N possibly damaging Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp4a12a A C 4: 115,327,274 K282T probably benign Het
Dtnb C T 12: 3,591,962 R42* probably null Het
Dyrk3 A G 1: 131,129,482 I318T probably damaging Het
Fam160b2 G A 14: 70,586,585 T535M probably damaging Het
Gm11110 T C 17: 57,103,435 probably benign Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
Igfn1 A G 1: 135,998,641 S24P probably benign Het
Inpp4b A G 8: 81,952,261 M307V possibly damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kmt2a A C 9: 44,820,097 probably benign Het
Limk1 A G 5: 134,672,669 probably null Het
Lrrc14 T A 15: 76,713,118 probably null Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mug2 T C 6: 122,047,506 probably benign Het
Myo15 G A 11: 60,510,300 probably null Het
Nup98 T C 7: 102,184,877 T293A probably benign Het
Nwd2 A T 5: 63,800,161 Y278F probably damaging Het
Olfr101 T A 17: 37,299,870 D184V probably benign Het
Phactr4 A C 4: 132,369,747 D496E probably benign Het
Pramel6 T A 2: 87,510,796 probably null Het
Ptprq C T 10: 107,582,476 A1680T probably damaging Het
Retnlb T A 16: 48,818,645 C70S probably damaging Het
Ros1 C A 10: 52,128,416 probably null Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Sos2 T C 12: 69,603,553 N865D probably damaging Het
Sp9 G A 2: 73,273,971 A290T probably benign Het
Spg11 C T 2: 122,071,053 V1469I probably benign Het
Unc13c G T 9: 73,930,653 A972D possibly damaging Het
Vwa3a T C 7: 120,799,111 L945P probably damaging Het
Other mutations in Caskin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Caskin1 APN 17 24503889 missense probably damaging 1.00
IGL00846:Caskin1 APN 17 24499349 critical splice donor site probably null
IGL01120:Caskin1 APN 17 24505369 missense possibly damaging 0.56
IGL01543:Caskin1 APN 17 24504548 missense probably benign
IGL01622:Caskin1 APN 17 24503940 critical splice donor site probably null
IGL01623:Caskin1 APN 17 24503940 critical splice donor site probably null
IGL02120:Caskin1 APN 17 24500942 missense probably damaging 1.00
IGL02816:Caskin1 APN 17 24502170 missense probably benign 0.06
IGL02898:Caskin1 APN 17 24502409 missense probably benign 0.00
IGL03353:Caskin1 APN 17 24499357 splice site probably benign
PIT4151001:Caskin1 UTSW 17 24502219 missense probably damaging 1.00
PIT4453001:Caskin1 UTSW 17 24499292 missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24504896 missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24504896 missense probably damaging 1.00
R0190:Caskin1 UTSW 17 24504622 missense possibly damaging 0.92
R0443:Caskin1 UTSW 17 24505400 missense probably damaging 0.96
R0885:Caskin1 UTSW 17 24505694 missense probably damaging 1.00
R1035:Caskin1 UTSW 17 24505037 missense probably damaging 1.00
R1253:Caskin1 UTSW 17 24505073 missense probably damaging 1.00
R1497:Caskin1 UTSW 17 24504541 nonsense probably null
R1589:Caskin1 UTSW 17 24505478 unclassified probably null
R1651:Caskin1 UTSW 17 24502212 missense possibly damaging 0.82
R1944:Caskin1 UTSW 17 24500771 missense probably damaging 0.99
R1969:Caskin1 UTSW 17 24506850 missense possibly damaging 0.94
R2057:Caskin1 UTSW 17 24496459 missense probably damaging 0.99
R2127:Caskin1 UTSW 17 24496996 critical splice donor site probably null
R2158:Caskin1 UTSW 17 24505154 missense probably benign
R2402:Caskin1 UTSW 17 24503808 missense probably damaging 1.00
R2895:Caskin1 UTSW 17 24489042 missense probably damaging 1.00
R3800:Caskin1 UTSW 17 24501272 missense probably benign
R4108:Caskin1 UTSW 17 24502147 missense probably benign
R4419:Caskin1 UTSW 17 24504709 missense probably damaging 1.00
R4510:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4511:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4552:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4638:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4642:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4644:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4824:Caskin1 UTSW 17 24501129 missense probably benign 0.01
R4882:Caskin1 UTSW 17 24504415 missense probably damaging 1.00
R4964:Caskin1 UTSW 17 24507161 missense probably damaging 1.00
R4966:Caskin1 UTSW 17 24507161 missense probably damaging 1.00
R5809:Caskin1 UTSW 17 24504547 missense probably benign 0.06
R5841:Caskin1 UTSW 17 24496209 missense probably damaging 0.99
R5877:Caskin1 UTSW 17 24505265 missense possibly damaging 0.69
R5960:Caskin1 UTSW 17 24498895 missense probably benign 0.31
R5994:Caskin1 UTSW 17 24496961 missense probably damaging 0.98
R6022:Caskin1 UTSW 17 24496735 missense probably benign 0.37
R6209:Caskin1 UTSW 17 24507121 missense possibly damaging 0.84
R6228:Caskin1 UTSW 17 24507180 missense probably damaging 0.99
R6287:Caskin1 UTSW 17 24496709 missense probably damaging 1.00
R6497:Caskin1 UTSW 17 24504548 missense probably benign
R6873:Caskin1 UTSW 17 24504179 missense probably benign 0.31
R7079:Caskin1 UTSW 17 24498884 missense probably benign 0.31
R7156:Caskin1 UTSW 17 24500683 splice site probably null
R7385:Caskin1 UTSW 17 24503924 missense probably damaging 1.00
X0022:Caskin1 UTSW 17 24505166 missense probably benign 0.34
X0063:Caskin1 UTSW 17 24507182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCACGGTGAGGACAGTCC -3'
(R):5'- CATGGCTAGAGTTCAACCTGG -3'

Sequencing Primer
(F):5'- AGGGACTCTGTCATACTTAGAACAC -3'
(R):5'- GCTAGAGTTCAACCTGGCTCTG -3'
Posted On2015-02-18