Incidental Mutation 'R3423:Olfr101'
ID267140
Institutional Source Beutler Lab
Gene Symbol Olfr101
Ensembl Gene ENSMUSG00000092077
Gene Nameolfactory receptor 101
SynonymsGA_x6K02T2PSCP-1761617-1760691, MOR250-2
MMRRC Submission 040641-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R3423 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37297556-37304313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37299870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 184 (D184V)
Ref Sequence ENSEMBL: ENSMUSP00000149851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058046] [ENSMUST00000214376] [ENSMUST00000215392]
Predicted Effect probably benign
Transcript: ENSMUST00000058046
AA Change: D184V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000061042
Gene: ENSMUSG00000092077
AA Change: D184V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.3e-53 PFAM
Pfam:7tm_1 39 289 3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214376
AA Change: D184V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215392
AA Change: D184V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8 A G 17: 32,316,455 F195S possibly damaging Het
Aldh3a1 G A 11: 61,215,536 A246T probably damaging Het
Caskin1 T A 17: 24,499,565 N331K probably damaging Het
Ceacam5 G A 7: 17,757,637 S644N possibly damaging Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp4a12a A C 4: 115,327,274 K282T probably benign Het
Dtnb C T 12: 3,591,962 R42* probably null Het
Dyrk3 A G 1: 131,129,482 I318T probably damaging Het
Fam160b2 G A 14: 70,586,585 T535M probably damaging Het
Gm11110 T C 17: 57,103,435 probably benign Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
Igfn1 A G 1: 135,998,641 S24P probably benign Het
Inpp4b A G 8: 81,952,261 M307V possibly damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kmt2a A C 9: 44,820,097 probably benign Het
Limk1 A G 5: 134,672,669 probably null Het
Lrrc14 T A 15: 76,713,118 probably null Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mug2 T C 6: 122,047,506 probably benign Het
Myo15 G A 11: 60,510,300 probably null Het
Nup98 T C 7: 102,184,877 T293A probably benign Het
Nwd2 A T 5: 63,800,161 Y278F probably damaging Het
Phactr4 A C 4: 132,369,747 D496E probably benign Het
Pramel6 T A 2: 87,510,796 probably null Het
Ptprq C T 10: 107,582,476 A1680T probably damaging Het
Retnlb T A 16: 48,818,645 C70S probably damaging Het
Ros1 C A 10: 52,128,416 probably null Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Sos2 T C 12: 69,603,553 N865D probably damaging Het
Sp9 G A 2: 73,273,971 A290T probably benign Het
Spg11 C T 2: 122,071,053 V1469I probably benign Het
Unc13c G T 9: 73,930,653 A972D possibly damaging Het
Vwa3a T C 7: 120,799,111 L945P probably damaging Het
Other mutations in Olfr101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Olfr101 APN 17 37299738 missense probably benign 0.00
IGL01584:Olfr101 APN 17 37299738 missense probably benign 0.00
IGL01609:Olfr101 APN 17 37299738 missense probably benign 0.00
IGL01739:Olfr101 APN 17 37299782 missense probably benign 0.00
IGL03203:Olfr101 APN 17 37300426 splice site probably benign
R1122:Olfr101 UTSW 17 37300128 missense probably damaging 1.00
R1132:Olfr101 UTSW 17 37299532 missense probably benign 0.19
R1237:Olfr101 UTSW 17 37300265 missense probably benign 0.19
R3872:Olfr101 UTSW 17 37299979 missense probably benign 0.00
R3873:Olfr101 UTSW 17 37299979 missense probably benign 0.00
R3874:Olfr101 UTSW 17 37299979 missense probably benign 0.00
R4871:Olfr101 UTSW 17 37300204 missense probably benign 0.03
R5213:Olfr101 UTSW 17 37300051 missense probably damaging 0.98
R5974:Olfr101 UTSW 17 37300338 missense possibly damaging 0.65
R6294:Olfr101 UTSW 17 37299553 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGGTAGACAGAGCTTTGTGG -3'
(R):5'- GTAGCACTGAGACCATGCTG -3'

Sequencing Primer
(F):5'- TTTGTGGAGCATGCTGCAAGAAC -3'
(R):5'- CAGTGATGGCATTTGACCGC -3'
Posted On2015-02-18