Incidental Mutation 'R3435:Olfr3'
ID267143
Institutional Source Beutler Lab
Gene Symbol Olfr3
Ensembl Gene ENSMUSG00000075384
Gene Nameolfactory receptor 3
SynonymsMOR136-14, Y71, GA_x6K02T2NLDC-33507606-33506665
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36811492-36817032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36812678 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 138 (Q138L)
Ref Sequence ENSEMBL: ENSMUSP00000149118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100151] [ENSMUST00000213988]
Predicted Effect probably benign
Transcript: ENSMUST00000100151
AA Change: Q138L

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097728
Gene: ENSMUSG00000075384
AA Change: Q138L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 220 2.9e-7 PFAM
Pfam:7tm_1 41 290 6.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120418
Predicted Effect probably benign
Transcript: ENSMUST00000213988
AA Change: Q138L

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.2155 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in Olfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Olfr3 APN 2 36812403 missense probably benign
R0501:Olfr3 UTSW 2 36812480 nonsense probably null
R0519:Olfr3 UTSW 2 36812615 missense probably damaging 1.00
R0890:Olfr3 UTSW 2 36812574 missense probably benign 0.06
R1353:Olfr3 UTSW 2 36812914 missense possibly damaging 0.59
R1543:Olfr3 UTSW 2 36813057 missense probably damaging 1.00
R4378:Olfr3 UTSW 2 36812469 missense probably benign
R4585:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4586:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4626:Olfr3 UTSW 2 36812259 missense probably damaging 0.98
R4714:Olfr3 UTSW 2 36813035 missense probably benign 0.37
R4720:Olfr3 UTSW 2 36812472 missense probably benign 0.03
R5390:Olfr3 UTSW 2 36812432 missense probably benign
R5659:Olfr3 UTSW 2 36812954 missense probably damaging 1.00
R5681:Olfr3 UTSW 2 36812681 missense probably benign 0.18
R6750:Olfr3 UTSW 2 36812942 missense possibly damaging 0.90
R7003:Olfr3 UTSW 2 36813035 missense possibly damaging 0.51
R7353:Olfr3 UTSW 2 36812903 missense probably damaging 1.00
R7514:Olfr3 UTSW 2 36812639 missense probably benign 0.03
R8094:Olfr3 UTSW 2 36812318 missense probably damaging 1.00
R8298:Olfr3 UTSW 2 36813026 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATAATGGCGGCCAAACCTG -3'
(R):5'- TGTCACTGTCCCGAAGATGTTAAC -3'

Sequencing Primer
(F):5'- ACCTGCTGTGAAGATTACCAG -3'
(R):5'- CTGTCCCGAAGATGTTAACAAAAG -3'
Posted On2015-02-18