Incidental Mutation 'R3435:4933409G03Rik'
ID267144
Institutional Source Beutler Lab
Gene Symbol 4933409G03Rik
Ensembl Gene ENSMUSG00000053896
Gene NameRIKEN cDNA 4933409G03 gene
Synonyms
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location68582413-68616463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 68601845 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 91 (D91A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102713]
Predicted Effect unknown
Transcript: ENSMUST00000102713
AA Change: D110A
SMART Domains Protein: ENSMUSP00000099774
Gene: ENSMUSG00000053896
AA Change: D110A

DomainStartEndE-ValueType
low complexity region 74 86 N/A INTRINSIC
low complexity region 89 133 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137117
AA Change: D91A
SMART Domains Protein: ENSMUSP00000117165
Gene: ENSMUSG00000053896
AA Change: D91A

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
low complexity region 71 115 N/A INTRINSIC
low complexity region 176 188 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in 4933409G03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:4933409G03Rik APN 2 68601898 missense unknown
IGL00514:4933409G03Rik APN 2 68601797 missense unknown
IGL02173:4933409G03Rik APN 2 68613057 missense unknown
IGL02252:4933409G03Rik APN 2 68614334 splice site probably benign
PIT4812001:4933409G03Rik UTSW 2 68588948 missense probably benign 0.16
R0196:4933409G03Rik UTSW 2 68616247 unclassified probably benign
R1939:4933409G03Rik UTSW 2 68588984 missense possibly damaging 0.83
R2422:4933409G03Rik UTSW 2 68591520 missense probably benign 0.16
R4124:4933409G03Rik UTSW 2 68616224 unclassified probably benign
R4243:4933409G03Rik UTSW 2 68593543 intron probably benign
R4424:4933409G03Rik UTSW 2 68615147 unclassified probably benign
R4649:4933409G03Rik UTSW 2 68606215 missense unknown
R4650:4933409G03Rik UTSW 2 68606215 missense unknown
R4651:4933409G03Rik UTSW 2 68606215 missense unknown
R4652:4933409G03Rik UTSW 2 68606215 missense unknown
R4653:4933409G03Rik UTSW 2 68606215 missense unknown
R4732:4933409G03Rik UTSW 2 68614721 unclassified probably benign
R4733:4933409G03Rik UTSW 2 68614721 unclassified probably benign
R5144:4933409G03Rik UTSW 2 68616260 unclassified probably benign
R5499:4933409G03Rik UTSW 2 68601793 missense unknown
R5828:4933409G03Rik UTSW 2 68601800 missense unknown
R5936:4933409G03Rik UTSW 2 68615504 unclassified probably benign
R6323:4933409G03Rik UTSW 2 68606224 missense unknown
R7491:4933409G03Rik UTSW 2 68614755 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCCTGTCAGATGGTAAGGC -3'
(R):5'- AGAAGATTACTTGAAGGTGTTTGC -3'

Sequencing Primer
(F):5'- AAGGCTTAAGGTTACTGTGCATTCC -3'
(R):5'- CATTTGGCTGGTGCTACACTAG -3'
Posted On2015-02-18