Incidental Mutation 'R3435:Mup6'
ID267152
Institutional Source Beutler Lab
Gene Symbol Mup6
Ensembl Gene ENSMUSG00000078689
Gene Namemajor urinary protein 6
SynonymsGm12544
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59964294-60007274 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to T at 60004116 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107517] [ENSMUST00000107520] [ENSMUST00000107521]
Predicted Effect probably null
Transcript: ENSMUST00000107517
SMART Domains Protein: ENSMUSP00000103141
Gene: ENSMUSG00000078689

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lipocalin 33 172 1.6e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107520
SMART Domains Protein: ENSMUSP00000103144
Gene: ENSMUSG00000078689

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lipocalin 33 172 1.6e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107521
SMART Domains Protein: ENSMUSP00000103145
Gene: ENSMUSG00000078689

DomainStartEndE-ValueType
Pfam:Lipocalin 25 164 1.4e-35 PFAM
Meta Mutation Damage Score 0.6048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in Mup6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Mup6 APN 4 60006001 missense probably damaging 1.00
IGL01333:Mup6 APN 4 60005529 missense probably damaging 1.00
IGL01608:Mup6 APN 4 60006021 missense probably benign 0.34
IGL02471:Mup6 APN 4 60003971 splice site probably benign
IGL02932:Mup6 APN 4 60006009 missense probably damaging 1.00
IGL03070:Mup6 APN 4 60003999 missense probably damaging 1.00
IGL03108:Mup6 APN 4 60005990 missense possibly damaging 0.55
IGL03158:Mup6 APN 4 60005480 missense possibly damaging 0.83
R0122:Mup6 UTSW 4 60003995 nonsense probably null
R1271:Mup6 UTSW 4 60003579 intron probably benign
R3434:Mup6 UTSW 4 60004116 splice site probably null
R4258:Mup6 UTSW 4 60004812 critical splice acceptor site probably null
R4465:Mup6 UTSW 4 60004000 missense probably damaging 1.00
R4466:Mup6 UTSW 4 60004000 missense probably damaging 1.00
R5021:Mup6 UTSW 4 59964352 missense probably damaging 0.99
R5272:Mup6 UTSW 4 60005922 missense probably damaging 0.99
R6396:Mup6 UTSW 4 60004837 missense possibly damaging 0.84
R6861:Mup6 UTSW 4 60004093 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATGCATGTGGTATCCCTGC -3'
(R):5'- CTCCTAGTGAATTAATTCCTGTCAC -3'

Sequencing Primer
(F):5'- GCATGTGGTATCCCTGCTTCTTC -3'
(R):5'- AGTGAATTAATTCCTGTCACCAATTC -3'
Posted On2015-02-18