Incidental Mutation 'R3435:Ift74'
ID267153
Institutional Source Beutler Lab
Gene Symbol Ift74
Ensembl Gene ENSMUSG00000028576
Gene Nameintraflagellar transport 74
SynonymsCmg1, 1700029H06Rik, Ccdc2, b2b796Clo
MMRRC Submission 040653-MU
Accession Numbers

NCBI RefSeq: NM_026319.2; MGI: 1914944

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location94614491-94693229 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 94621852 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030311] [ENSMUST00000030311] [ENSMUST00000107104] [ENSMUST00000107104]
Predicted Effect probably null
Transcript: ENSMUST00000030311
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000030311
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107104
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107104
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart disease associated with heterotaxy. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(2) Gene trapped(21)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in Ift74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ift74 APN 4 94693022 missense probably damaging 1.00
IGL01534:Ift74 APN 4 94679944 missense probably benign 0.00
IGL01701:Ift74 APN 4 94662658 missense possibly damaging 0.94
IGL02155:Ift74 APN 4 94679251 missense probably benign
IGL02455:Ift74 APN 4 94635831 nonsense probably null
IGL02877:Ift74 APN 4 94624781 critical splice donor site probably null
IGL03389:Ift74 APN 4 94621912 missense possibly damaging 0.57
P0005:Ift74 UTSW 4 94662576 splice site probably benign
PIT4243001:Ift74 UTSW 4 94686904 missense possibly damaging 0.94
R0211:Ift74 UTSW 4 94679255 missense probably benign 0.05
R0211:Ift74 UTSW 4 94679255 missense probably benign 0.05
R1019:Ift74 UTSW 4 94635835 missense probably benign 0.20
R1240:Ift74 UTSW 4 94692937 splice site probably null
R1699:Ift74 UTSW 4 94685703 missense probably benign 0.09
R1937:Ift74 UTSW 4 94662646 missense probably benign 0.10
R2114:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2116:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2117:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2181:Ift74 UTSW 4 94632714 missense probably damaging 0.98
R2680:Ift74 UTSW 4 94653028 missense probably damaging 1.00
R3434:Ift74 UTSW 4 94621852 critical splice acceptor site probably null
R4080:Ift74 UTSW 4 94652912 splice site probably null
R4379:Ift74 UTSW 4 94679934 missense probably benign 0.00
R4777:Ift74 UTSW 4 94652997 missense probably benign 0.00
R5197:Ift74 UTSW 4 94662596 missense probably benign 0.00
R5934:Ift74 UTSW 4 94632734 missense probably benign
R5994:Ift74 UTSW 4 94691724 missense possibly damaging 0.86
R6639:Ift74 UTSW 4 94664259 intron probably benign
R6781:Ift74 UTSW 4 94627302 missense probably damaging 1.00
R7156:Ift74 UTSW 4 94660952 missense possibly damaging 0.95
R7239:Ift74 UTSW 4 94652950 missense probably benign 0.00
R7899:Ift74 UTSW 4 94621977 missense possibly damaging 0.90
R8814:Ift74 UTSW 4 94662636 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCGAAACACTAGATTCTGTAAAAGAG -3'
(R):5'- AGGATGTGCTATAACAGTTTTGGAAC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CAGGACGATCAGCAACTT -3'
Posted On2015-02-18