Incidental Mutation 'R3435:Mafk'
ID267157
Institutional Source Beutler Lab
Gene Symbol Mafk
Ensembl Gene ENSMUSG00000018143
Gene Namev-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian)
SynonymsNF-E2, p18 NF-E2, Nfe2u
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139791513-139802653 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 139800307 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 87 (Q87*)
Ref Sequence ENSEMBL: ENSMUSP00000106460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018287] [ENSMUST00000044002] [ENSMUST00000110832] [ENSMUST00000110836]
Predicted Effect probably null
Transcript: ENSMUST00000018287
AA Change: Q87*
SMART Domains Protein: ENSMUSP00000018287
Gene: ENSMUSG00000018143
AA Change: Q87*

DomainStartEndE-ValueType
BRLZ 49 113 1.83e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044002
SMART Domains Protein: ENSMUSP00000035399
Gene: ENSMUSG00000036687

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 46 54 N/A INTRINSIC
Pfam:Solute_trans_a 82 356 2.2e-93 PFAM
low complexity region 408 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110832
SMART Domains Protein: ENSMUSP00000106456
Gene: ENSMUSG00000036687

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
Pfam:Solute_trans_a 55 332 6.7e-101 PFAM
low complexity region 384 411 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110836
AA Change: Q87*
SMART Domains Protein: ENSMUSP00000106460
Gene: ENSMUSG00000018143
AA Change: Q87*

DomainStartEndE-ValueType
BRLZ 49 113 1.83e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151577
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The developmentally regulated expression of the globin genes depends on upstream regulatory elements termed locus control regions (LCRs). LCRs are associated with powerful enhancer activity that is mediated by the transcription factor NFE2 (nuclear factor erythroid-2). NFE2 recognition sites are also present in the gene promoters of 2 heme biosynthetic enzymes, porphobilinogen deaminase (PBGD; MIM 609806) and ferrochelatase (FECH; MIM 612386). NFE2 DNA-binding activity consists of a heterodimer containing an 18-kD Maf protein (MafF, MafG (MIM 602020), or MafK) and p45 (MIM 601490). Both subunits are members of the activator protein-1 superfamily of basic leucine zipper (bZIP) proteins (see MIM 165160). Maf homodimers suppress transcription at NFE2 sites.[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, healthy and phenotypically normal with no detectable erythroid deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in Mafk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Mafk APN 5 139800493 missense probably damaging 0.98
R1587:Mafk UTSW 5 139800145 missense probably damaging 1.00
R4694:Mafk UTSW 5 139800493 missense probably damaging 0.98
R6330:Mafk UTSW 5 139799193 missense probably benign 0.02
R7089:Mafk UTSW 5 139800121 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTTTAGGTCAAGAAGGAGGCG -3'
(R):5'- GCAGATTTGACGATGGTGATGAC -3'

Sequencing Primer
(F):5'- GTGAGAACGCCCCTGTTCTTAG -3'
(R):5'- TGACGATGGTGATGACACTGG -3'
Posted On2015-02-18