Incidental Mutation 'R3435:Osbpl3'
ID267159
Institutional Source Beutler Lab
Gene Symbol Osbpl3
Ensembl Gene ENSMUSG00000029822
Gene Nameoxysterol binding protein-like 3
Synonyms6720421I08Rik, OSBP3, ORP3, 1200014M06Rik
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location50293330-50456201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50348070 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 149 (N149K)
Ref Sequence ENSEMBL: ENSMUSP00000110112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071728] [ENSMUST00000090019] [ENSMUST00000114466] [ENSMUST00000114468] [ENSMUST00000136926] [ENSMUST00000146341] [ENSMUST00000203907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071728
AA Change: N149K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071643
Gene: ENSMUSG00000029822
AA Change: N149K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 392 425 N/A INTRINSIC
Pfam:Oxysterol_BP 459 804 3.2e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090019
AA Change: N149K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087473
Gene: ENSMUSG00000029822
AA Change: N149K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 4e-25 BLAST
low complexity region 459 492 N/A INTRINSIC
Pfam:Oxysterol_BP 526 870 3e-136 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114466
AA Change: N149K

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110110
Gene: ENSMUSG00000029822
AA Change: N149K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 288 342 3e-25 BLAST
low complexity region 423 456 N/A INTRINSIC
Pfam:Oxysterol_BP 490 835 3.5e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114468
AA Change: N149K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110112
Gene: ENSMUSG00000029822
AA Change: N149K

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 147 9.56e-11 SMART
low complexity region 177 191 N/A INTRINSIC
Blast:PH 254 311 4e-25 BLAST
low complexity region 428 461 N/A INTRINSIC
Pfam:Oxysterol_BP 495 840 1.3e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133141
Predicted Effect probably benign
Transcript: ENSMUST00000136926
SMART Domains Protein: ENSMUSP00000144934
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
SCOP:d1btka_ 50 75 5e-4 SMART
Blast:PH 51 76 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000146341
SMART Domains Protein: ENSMUSP00000114472
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
PH 51 144 1.27e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203907
SMART Domains Protein: ENSMUSP00000145249
Gene: ENSMUSG00000029822

DomainStartEndE-ValueType
Blast:PH 1 91 1e-57 BLAST
low complexity region 208 241 N/A INTRINSIC
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. The encoded protein is involved in the regulation of cell adhesion and organization of the actin cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in Osbpl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Osbpl3 APN 6 50323068 missense probably damaging 1.00
IGL01784:Osbpl3 APN 6 50344922 missense probably damaging 1.00
IGL02221:Osbpl3 APN 6 50327367 unclassified probably benign
IGL02323:Osbpl3 APN 6 50346326 critical splice donor site probably null
IGL02894:Osbpl3 APN 6 50346332 missense possibly damaging 0.89
H8562:Osbpl3 UTSW 6 50347466 missense probably benign 0.09
PIT4283001:Osbpl3 UTSW 6 50346088 missense probably benign 0.01
R0226:Osbpl3 UTSW 6 50353008 missense probably damaging 1.00
R0416:Osbpl3 UTSW 6 50348018 missense probably benign
R0417:Osbpl3 UTSW 6 50348018 missense probably benign
R0601:Osbpl3 UTSW 6 50299403 missense probably benign 0.05
R0826:Osbpl3 UTSW 6 50346377 missense probably damaging 1.00
R1390:Osbpl3 UTSW 6 50308427 missense probably damaging 1.00
R1520:Osbpl3 UTSW 6 50346431 missense possibly damaging 0.75
R1603:Osbpl3 UTSW 6 50323093 missense probably damaging 1.00
R1678:Osbpl3 UTSW 6 50336213 critical splice donor site probably null
R1843:Osbpl3 UTSW 6 50370143 missense probably damaging 1.00
R1943:Osbpl3 UTSW 6 50320074 missense probably benign 0.16
R3768:Osbpl3 UTSW 6 50348002 missense possibly damaging 0.64
R4746:Osbpl3 UTSW 6 50328674 missense probably damaging 0.99
R4751:Osbpl3 UTSW 6 50300997 missense possibly damaging 0.95
R4776:Osbpl3 UTSW 6 50300973 missense probably benign 0.01
R4814:Osbpl3 UTSW 6 50353000 missense probably damaging 1.00
R4841:Osbpl3 UTSW 6 50309376 missense probably damaging 1.00
R4881:Osbpl3 UTSW 6 50352784 missense possibly damaging 0.95
R4999:Osbpl3 UTSW 6 50336297 missense probably damaging 0.99
R5512:Osbpl3 UTSW 6 50309360 missense probably damaging 0.98
R6282:Osbpl3 UTSW 6 50348083 splice site probably null
R6304:Osbpl3 UTSW 6 50312674 missense probably damaging 1.00
R6905:Osbpl3 UTSW 6 50351882 missense probably damaging 1.00
R7000:Osbpl3 UTSW 6 50297157 missense probably damaging 1.00
R7102:Osbpl3 UTSW 6 50320135 missense probably damaging 1.00
R7275:Osbpl3 UTSW 6 50346430 missense probably benign 0.02
R7334:Osbpl3 UTSW 6 50344906 missense possibly damaging 0.78
R7368:Osbpl3 UTSW 6 50348098 missense probably damaging 1.00
R8052:Osbpl3 UTSW 6 50346015 missense probably damaging 1.00
R8183:Osbpl3 UTSW 6 50303109 missense probably benign 0.00
R8810:Osbpl3 UTSW 6 50351872 missense probably damaging 1.00
RF011:Osbpl3 UTSW 6 50348138 critical splice acceptor site probably benign
Z1088:Osbpl3 UTSW 6 50297097 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACTGGTCAAGAGACTAACTGGG -3'
(R):5'- ACCAAGACAGTACATGCAGTTTC -3'

Sequencing Primer
(F):5'- GTACCAACCTCCAACCTACCCTG -3'
(R):5'- ACATGCAGTTTCTTATTTTTCATGC -3'
Posted On2015-02-18