Incidental Mutation 'R3435:Vmn1r209'
ID267164
Institutional Source Beutler Lab
Gene Symbol Vmn1r209
Ensembl Gene ENSMUSG00000071491
Gene Namevomeronasal 1 receptor 209
SynonymsGm11315
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22800629-22809682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22806097 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 141 (M141K)
Ref Sequence ENSEMBL: ENSMUSP00000153997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095961] [ENSMUST00000227038] [ENSMUST00000227265]
Predicted Effect probably benign
Transcript: ENSMUST00000095961
AA Change: M141K

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093657
Gene: ENSMUSG00000071491
AA Change: M141K

DomainStartEndE-ValueType
Pfam:TAS2R 2 294 9.8e-9 PFAM
Pfam:V1R 34 297 3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227038
AA Change: M141K

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000227265
AA Change: M141K

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Other mutations in Vmn1r209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Vmn1r209 APN 13 22806280 missense probably damaging 1.00
IGL01788:Vmn1r209 APN 13 22805662 missense probably damaging 0.97
IGL02738:Vmn1r209 APN 13 22806120 nonsense probably null
IGL03177:Vmn1r209 APN 13 22805854 missense possibly damaging 0.46
IGL03199:Vmn1r209 APN 13 22806050 missense possibly damaging 0.89
R0437:Vmn1r209 UTSW 13 22806356 missense probably benign 0.01
R0497:Vmn1r209 UTSW 13 22805948 missense probably damaging 1.00
R0506:Vmn1r209 UTSW 13 22805944 missense probably damaging 0.98
R1496:Vmn1r209 UTSW 13 22805764 missense probably damaging 1.00
R1644:Vmn1r209 UTSW 13 22806482 missense possibly damaging 0.52
R1829:Vmn1r209 UTSW 13 22806239 missense possibly damaging 0.95
R2360:Vmn1r209 UTSW 13 22805666 missense probably damaging 1.00
R3434:Vmn1r209 UTSW 13 22806097 missense probably benign 0.04
R4082:Vmn1r209 UTSW 13 22805615 missense probably null 0.15
R4451:Vmn1r209 UTSW 13 22806498 missense probably benign 0.02
R4616:Vmn1r209 UTSW 13 22805965 missense probably damaging 1.00
R4618:Vmn1r209 UTSW 13 22806449 missense possibly damaging 0.87
R4801:Vmn1r209 UTSW 13 22805656 missense probably damaging 1.00
R4802:Vmn1r209 UTSW 13 22805656 missense probably damaging 1.00
R6035:Vmn1r209 UTSW 13 22806032 missense probably benign 0.02
R6035:Vmn1r209 UTSW 13 22806032 missense probably benign 0.02
R6908:Vmn1r209 UTSW 13 22806230 missense possibly damaging 0.60
R7162:Vmn1r209 UTSW 13 22805958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAATACCATGTAGCCACTGG -3'
(R):5'- ATTGCCAAAGACAGTAGCAGC -3'

Sequencing Primer
(F):5'- ACTGGCCCCTCCCATAG -3'
(R):5'- GGTTTGAGAAACTTCCTAGATGCC -3'
Posted On2015-02-18