Incidental Mutation 'R3435:Neurl1a'
ID267172
Institutional Source Beutler Lab
Gene Symbol Neurl1a
Ensembl Gene ENSMUSG00000006435
Gene Nameneuralized E3 ubiquitin protein ligase 1A
SynonymsNeur1, Rnf67, Neurl, Neu1, Nlz, 2410129E16Rik
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R3435 (G1)
Quality Score178
Status Validated
Chromosome19
Chromosomal Location47178820-47259440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47257525 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 532 (V532A)
Ref Sequence ENSEMBL: ENSMUSP00000107439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081619] [ENSMUST00000111800] [ENSMUST00000111807] [ENSMUST00000111808]
Predicted Effect probably benign
Transcript: ENSMUST00000081619
SMART Domains Protein: ENSMUSP00000080325
Gene: ENSMUSG00000053617

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
low complexity region 242 254 N/A INTRINSIC
SH3 269 324 6.49e-16 SMART
low complexity region 360 371 N/A INTRINSIC
SH3 450 505 4.49e-10 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 632 652 N/A INTRINSIC
low complexity region 654 676 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
SH3 836 891 2.41e-10 SMART
SH3 1066 1124 3.85e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111800
SMART Domains Protein: ENSMUSP00000107430
Gene: ENSMUSG00000053617

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
SH3 241 296 6.49e-16 SMART
low complexity region 332 343 N/A INTRINSIC
SH3 422 477 4.49e-10 SMART
low complexity region 491 509 N/A INTRINSIC
low complexity region 604 624 N/A INTRINSIC
low complexity region 626 648 N/A INTRINSIC
low complexity region 657 681 N/A INTRINSIC
SH3 808 863 2.41e-10 SMART
SH3 1038 1096 3.85e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111807
AA Change: V515A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107438
Gene: ENSMUSG00000006435
AA Change: V515A

DomainStartEndE-ValueType
NEUZ 43 166 8.33e-66 SMART
Blast:NEUZ 186 213 1e-8 BLAST
low complexity region 241 253 N/A INTRINSIC
NEUZ 274 397 1.79e-56 SMART
low complexity region 440 456 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
RING 504 543 2.22e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111808
AA Change: V532A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107439
Gene: ENSMUSG00000006435
AA Change: V532A

DomainStartEndE-ValueType
NEUZ 60 183 8.33e-66 SMART
Blast:NEUZ 203 230 9e-9 BLAST
low complexity region 258 270 N/A INTRINSIC
NEUZ 291 414 1.79e-56 SMART
low complexity region 457 473 N/A INTRINSIC
low complexity region 486 499 N/A INTRINSIC
RING 521 560 2.22e-2 SMART
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Depending on the targeted mutation, homozygotes show a spectrum of conflicting phenotypes ranging from axonemal and spermatid abnormalities, male sterility and deficient lactation, to just a specific olfactory discrimination defect and ethanol hypersensitivity on motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in Neurl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03186:Neurl1a APN 19 47240477 missense probably damaging 0.99
R1403:Neurl1a UTSW 19 47253711 missense probably damaging 1.00
R1822:Neurl1a UTSW 19 47257459 missense probably benign 0.16
R3040:Neurl1a UTSW 19 47239831 missense probably benign 0.00
R3767:Neurl1a UTSW 19 47239889 missense probably damaging 1.00
R3770:Neurl1a UTSW 19 47239889 missense probably damaging 1.00
R3884:Neurl1a UTSW 19 47253446 missense probably benign 0.30
R4539:Neurl1a UTSW 19 47256744 missense probably damaging 1.00
R5108:Neurl1a UTSW 19 47257635 missense probably damaging 1.00
R5644:Neurl1a UTSW 19 47179477 missense probably benign
R6167:Neurl1a UTSW 19 47239928 missense probably damaging 1.00
R7353:Neurl1a UTSW 19 47240660 missense probably damaging 1.00
X0063:Neurl1a UTSW 19 47253674 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTTGCGTAGTGGCAGAAGAC -3'
(R):5'- AAGGGACCCTGTTGGCTTTG -3'

Sequencing Primer
(F):5'- TAGTGGCAGAAGACATGAGCTG -3'
(R):5'- GCTTTGCCCTCAGCTGGTG -3'
Posted On2015-02-18