Incidental Mutation 'R3436:Ambp'
ID267181
Institutional Source Beutler Lab
Gene Symbol Ambp
Ensembl Gene ENSMUSG00000028356
Gene Namealpha 1 microglobulin/bikunin
SynonymsUTI, Urinary Trypsin Inhibitor, ulinastatin, Itil, HI-30, Intin4, ASPI
MMRRC Submission 040654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R3436 (G1)
Quality Score199
Status Validated
Chromosome4
Chromosomal Location63143275-63154799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63149484 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 163 (E163G)
Ref Sequence ENSEMBL: ENSMUSP00000030041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030041] [ENSMUST00000142901]
Predicted Effect probably benign
Transcript: ENSMUST00000030041
AA Change: E163G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000030041
Gene: ENSMUSG00000028356
AA Change: E163G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:Lipocalin 40 185 4.4e-32 PFAM
KU 228 281 1.55e-20 SMART
KU 284 337 4.58e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142901
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a fusion protein that undergoes proteolytic processing to generate two mature proteins: alpha-1-microglobulin (A1m) is a heme-binding plasma glycoprotein of the lipocalin superfamily of proteins that bind to hydrophobic molecules, whereas bikunin belongs to the superfamily of Kunitz-type protease inhibitors. The transgenic mice specifically lacking bikunin, but not A1m, exhibit female infertility and an increased sensitivity to lung metastasis. [provided by RefSeq, Oct 2015]
PHENOTYPE: Female homozygotes for targeted null mutations exhibit reduced ovulation rates, oocytes lacking a zona pellucida, and a very low fertilization rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Cadps A T 14: 12,616,158 probably null Het
Ccdc146 A G 5: 21,297,005 S804P possibly damaging Het
Cdc20b T C 13: 113,078,699 I267T probably damaging Het
Cdh8 A G 8: 99,400,718 probably benign Het
Dse G T 10: 34,152,474 N873K probably benign Het
Ehd1 G T 19: 6,277,014 E14* probably null Het
F8 A G X: 75,267,424 probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Fndc1 T C 17: 7,750,357 K1559E probably damaging Het
Ighg1 T C 12: 113,329,560 E170G probably damaging Het
Kmt2b G T 7: 30,576,692 P1794Q probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1189 T A 2: 88,592,104 F100Y probably damaging Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr138 G A 17: 38,275,530 G253D probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Pkd1l2 T C 8: 117,040,739 N1271D probably benign Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Prr16 A G 18: 51,303,123 N225D probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Sort1 T A 3: 108,337,807 I325N probably damaging Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Tmprss11b A T 5: 86,667,584 Y48* probably null Het
Tpp2 T C 1: 43,940,144 I67T probably damaging Het
Trdn G A 10: 33,468,195 probably null Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Trim17 T C 11: 58,965,233 C39R probably damaging Het
Trim52 C T 14: 106,107,307 P133L possibly damaging Het
Unc13b T C 4: 43,097,028 probably benign Het
Vmn2r94 G A 17: 18,258,388 probably benign Het
Vsig4 A G X: 96,290,816 V29A probably benign Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wnk3 T A X: 151,286,304 F886I probably benign Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfp507 A T 7: 35,787,770 Y234N probably damaging Het
Other mutations in Ambp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Ambp APN 4 63154018 missense possibly damaging 0.93
IGL00769:Ambp APN 4 63144165 missense probably damaging 0.99
IGL01400:Ambp APN 4 63152722 missense probably damaging 1.00
IGL01646:Ambp APN 4 63148740 missense probably benign 0.04
IGL02338:Ambp APN 4 63143697 missense probably damaging 1.00
IGL02796:Ambp APN 4 63153932 splice site probably benign
PIT4131001:Ambp UTSW 4 63144265 missense probably damaging 1.00
PIT4791001:Ambp UTSW 4 63154061 start gained probably benign
R0885:Ambp UTSW 4 63151468 missense probably damaging 0.98
R1725:Ambp UTSW 4 63144276 missense possibly damaging 0.92
R1999:Ambp UTSW 4 63149429 missense possibly damaging 0.63
R2023:Ambp UTSW 4 63151465 missense probably damaging 1.00
R2290:Ambp UTSW 4 63143687 missense probably damaging 1.00
R3437:Ambp UTSW 4 63149484 missense probably benign 0.03
R4078:Ambp UTSW 4 63150443 missense probably damaging 0.98
R4409:Ambp UTSW 4 63152647 missense probably damaging 1.00
R4979:Ambp UTSW 4 63152651 missense probably benign 0.07
R6738:Ambp UTSW 4 63149474 missense probably benign
R6818:Ambp UTSW 4 63154006 nonsense probably null
R6890:Ambp UTSW 4 63150359 missense probably benign 0.44
R8022:Ambp UTSW 4 63144197 missense probably damaging 1.00
X0057:Ambp UTSW 4 63149505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCTCTCTCAGTCTCTGTAG -3'
(R):5'- TAAGGACCCAGGACCTATGGTG -3'

Sequencing Primer
(F):5'- TCTCTGTAGAGAGGGAGAGGACC -3'
(R):5'- GGCCCAGTCTCTCTCTTGGAG -3'
Posted On2015-02-18