Incidental Mutation 'R3436:Tmem132e'
ID267198
Institutional Source Beutler Lab
Gene Symbol Tmem132e
Ensembl Gene ENSMUSG00000020701
Gene Nametransmembrane protein 132E
SynonymsLOC270893
MMRRC Submission 040654-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R3436 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82388900-82446332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82444330 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 654 (Y654C)
Ref Sequence ENSEMBL: ENSMUSP00000090528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054245] [ENSMUST00000092852]
Predicted Effect probably damaging
Transcript: ENSMUST00000054245
AA Change: Y746C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052484
Gene: ENSMUSG00000020701
AA Change: Y746C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:TMEM132D_N 45 176 1.1e-52 PFAM
low complexity region 202 216 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
Pfam:TMEM132 451 797 1.7e-136 PFAM
low complexity region 827 837 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
Pfam:TMEM132D_C 867 944 2e-34 PFAM
low complexity region 967 998 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1036 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092852
AA Change: Y654C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090528
Gene: ENSMUSG00000020701
AA Change: Y654C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 226 236 N/A INTRINSIC
low complexity region 471 489 N/A INTRINSIC
low complexity region 735 745 N/A INTRINSIC
low complexity region 749 762 N/A INTRINSIC
transmembrane domain 798 820 N/A INTRINSIC
low complexity region 875 906 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
low complexity region 944 951 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202598
Meta Mutation Damage Score 0.6213 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambp T C 4: 63,149,484 E163G probably benign Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Cadps A T 14: 12,616,158 probably null Het
Ccdc146 A G 5: 21,297,005 S804P possibly damaging Het
Cdc20b T C 13: 113,078,699 I267T probably damaging Het
Cdh8 A G 8: 99,400,718 probably benign Het
Dse G T 10: 34,152,474 N873K probably benign Het
Ehd1 G T 19: 6,277,014 E14* probably null Het
F8 A G X: 75,267,424 probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Fndc1 T C 17: 7,750,357 K1559E probably damaging Het
Ighg1 T C 12: 113,329,560 E170G probably damaging Het
Kmt2b G T 7: 30,576,692 P1794Q probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1189 T A 2: 88,592,104 F100Y probably damaging Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr138 G A 17: 38,275,530 G253D probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Pkd1l2 T C 8: 117,040,739 N1271D probably benign Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Prr16 A G 18: 51,303,123 N225D probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Sort1 T A 3: 108,337,807 I325N probably damaging Het
Tmprss11b A T 5: 86,667,584 Y48* probably null Het
Tpp2 T C 1: 43,940,144 I67T probably damaging Het
Trdn G A 10: 33,468,195 probably null Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Trim17 T C 11: 58,965,233 C39R probably damaging Het
Trim52 C T 14: 106,107,307 P133L possibly damaging Het
Unc13b T C 4: 43,097,028 probably benign Het
Vmn2r94 G A 17: 18,258,388 probably benign Het
Vsig4 A G X: 96,290,816 V29A probably benign Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wnk3 T A X: 151,286,304 F886I probably benign Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfp507 A T 7: 35,787,770 Y234N probably damaging Het
Other mutations in Tmem132e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Tmem132e APN 11 82438374 missense probably damaging 1.00
IGL01586:Tmem132e APN 11 82434669 missense probably damaging 1.00
IGL01729:Tmem132e APN 11 82435116 missense possibly damaging 0.89
IGL02592:Tmem132e APN 11 82434636 missense probably damaging 1.00
R0029:Tmem132e UTSW 11 82444761 missense probably damaging 1.00
R0501:Tmem132e UTSW 11 82435068 missense possibly damaging 0.90
R0612:Tmem132e UTSW 11 82443372 missense probably damaging 1.00
R0613:Tmem132e UTSW 11 82438338 missense probably damaging 1.00
R1311:Tmem132e UTSW 11 82444296 missense probably damaging 1.00
R1430:Tmem132e UTSW 11 82438296 missense probably damaging 1.00
R1607:Tmem132e UTSW 11 82437370 missense probably benign 0.39
R1710:Tmem132e UTSW 11 82443517 missense probably damaging 1.00
R1913:Tmem132e UTSW 11 82443417 missense probably damaging 1.00
R1951:Tmem132e UTSW 11 82445082 missense possibly damaging 0.84
R2018:Tmem132e UTSW 11 82445163 missense probably benign 0.26
R2051:Tmem132e UTSW 11 82440438 missense probably damaging 1.00
R2076:Tmem132e UTSW 11 82435068 missense possibly damaging 0.90
R2100:Tmem132e UTSW 11 82444531 missense probably damaging 1.00
R2325:Tmem132e UTSW 11 82434515 missense probably damaging 1.00
R2924:Tmem132e UTSW 11 82444323 missense probably damaging 1.00
R3437:Tmem132e UTSW 11 82444330 missense probably damaging 1.00
R4594:Tmem132e UTSW 11 82435068 missense possibly damaging 0.83
R4704:Tmem132e UTSW 11 82443531 missense probably damaging 0.97
R4754:Tmem132e UTSW 11 82444851 nonsense probably null
R4764:Tmem132e UTSW 11 82434512 missense probably damaging 0.99
R5245:Tmem132e UTSW 11 82442638 missense probably damaging 0.96
R5720:Tmem132e UTSW 11 82442450 splice site probably null
R5793:Tmem132e UTSW 11 82444858 missense probably damaging 1.00
R5984:Tmem132e UTSW 11 82445097 missense probably damaging 1.00
R6980:Tmem132e UTSW 11 82438386 critical splice donor site probably null
R7052:Tmem132e UTSW 11 82437363 missense probably damaging 0.99
R7637:Tmem132e UTSW 11 82434516 missense probably damaging 1.00
R7918:Tmem132e UTSW 11 82445290 missense probably damaging 1.00
R8262:Tmem132e UTSW 11 82434840 missense probably benign 0.33
R8772:Tmem132e UTSW 11 82434311 missense probably damaging 0.99
Z1177:Tmem132e UTSW 11 82435178 missense probably damaging 1.00
Z1177:Tmem132e UTSW 11 82445104 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGAGTCTCAGCTAGCACCTAG -3'
(R):5'- GAGTAGTAGCCAGCACACTCTTG -3'

Sequencing Primer
(F):5'- GCACCTAGCATTTCCAGTGTAAGG -3'
(R):5'- GCACACTCTTGCGCTTGG -3'
Posted On2015-02-18