Incidental Mutation 'R3436:F8'
ID267213
Institutional Source Beutler Lab
Gene Symbol F8
Ensembl Gene ENSMUSG00000031196
Gene Namecoagulation factor VIII
SynonymsFVIII, Cf8, Factor VIII, Cf-8
MMRRC Submission 040654-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R3436 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location75172715-75382615 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 75267424 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033539] [ENSMUST00000114085]
Predicted Effect probably benign
Transcript: ENSMUST00000033539
SMART Domains Protein: ENSMUSP00000033539
Gene: ENSMUSG00000031196

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Cu-oxidase_3 89 203 3.6e-7 PFAM
low complexity region 359 377 N/A INTRINSIC
Pfam:Cu-oxidase_3 444 577 8.8e-7 PFAM
low complexity region 1210 1231 N/A INTRINSIC
low complexity region 1268 1278 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
internal_repeat_1 1683 2005 3.96e-46 PROSPERO
FA58C 2007 2156 7.3e-48 SMART
FA58C 2160 2313 2.36e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114085
SMART Domains Protein: ENSMUSP00000109719
Gene: ENSMUSG00000031196

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Cu-oxidase_3 89 203 3.1e-7 PFAM
low complexity region 359 377 N/A INTRINSIC
Pfam:Cu-oxidase_3 446 577 7.4e-7 PFAM
low complexity region 1140 1161 N/A INTRINSIC
low complexity region 1198 1208 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
internal_repeat_2 1613 1838 3.99e-33 PROSPERO
internal_repeat_1 1615 1935 1.02e-41 PROSPERO
FA58C 1937 2086 7.3e-48 SMART
FA58C 2090 2243 2.36e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118416
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male hemizygotes and female homozygotes for targeted null mutations produce no factor VIII, but are apparently healthy and fertile. However, affected mice show prolonged, exsanguinating bleeding following tail-clipping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambp T C 4: 63,149,484 E163G probably benign Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Cadps A T 14: 12,616,158 probably null Het
Ccdc146 A G 5: 21,297,005 S804P possibly damaging Het
Cdc20b T C 13: 113,078,699 I267T probably damaging Het
Cdh8 A G 8: 99,400,718 probably benign Het
Dse G T 10: 34,152,474 N873K probably benign Het
Ehd1 G T 19: 6,277,014 E14* probably null Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Fndc1 T C 17: 7,750,357 K1559E probably damaging Het
Ighg1 T C 12: 113,329,560 E170G probably damaging Het
Kmt2b G T 7: 30,576,692 P1794Q probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1189 T A 2: 88,592,104 F100Y probably damaging Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr138 G A 17: 38,275,530 G253D probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Pkd1l2 T C 8: 117,040,739 N1271D probably benign Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Prr16 A G 18: 51,303,123 N225D probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Sort1 T A 3: 108,337,807 I325N probably damaging Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Tmprss11b A T 5: 86,667,584 Y48* probably null Het
Tpp2 T C 1: 43,940,144 I67T probably damaging Het
Trdn G A 10: 33,468,195 probably null Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Trim17 T C 11: 58,965,233 C39R probably damaging Het
Trim52 C T 14: 106,107,307 P133L possibly damaging Het
Unc13b T C 4: 43,097,028 probably benign Het
Vmn2r94 G A 17: 18,258,388 probably benign Het
Vsig4 A G X: 96,290,816 V29A probably benign Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wnk3 T A X: 151,286,304 F886I probably benign Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfp507 A T 7: 35,787,770 Y234N probably damaging Het
Other mutations in F8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:F8 APN X 75334180 unclassified probably benign
IGL01079:F8 APN X 75286618 missense probably damaging 0.98
IGL01101:F8 APN X 75287387 missense possibly damaging 0.62
IGL01160:F8 APN X 75288061 missense probably damaging 0.99
IGL01397:F8 APN X 75379539 missense probably benign
IGL02043:F8 APN X 75332641 missense probably benign 0.00
IGL02479:F8 APN X 75288240 missense probably damaging 0.98
IGL02505:F8 APN X 75379598 intron probably benign
IGL02869:F8 APN X 75287381 missense probably benign 0.00
IGL03004:F8 APN X 75212052 missense probably damaging 1.00
R0657:F8 UTSW X 75211416 missense possibly damaging 0.86
R0699:F8 UTSW X 75379624 intron probably benign
R2035:F8 UTSW X 75322998 frame shift probably null
R2037:F8 UTSW X 75322998 frame shift probably null
R3735:F8 UTSW X 75211375 missense probably damaging 1.00
R3736:F8 UTSW X 75211375 missense probably damaging 1.00
R3792:F8 UTSW X 75285365 critical splice donor site probably null
X0009:F8 UTSW X 75287783 missense probably benign 0.36
Z1088:F8 UTSW X 75323149 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTCTTCTCATACTGTGACATGATG -3'
(R):5'- GGATCCACAAAGTGCTGATTTTC -3'

Sequencing Primer
(F):5'- AGGCCTAGACCAGTAGTTCTC -3'
(R):5'- ACAAAGTGCTGATTTTCTTCTGC -3'
Posted On2015-02-18