Incidental Mutation 'R3438:Tanc2'
ID 267290
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Name tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms 5730590C14Rik, 3526402J09Rik
MMRRC Submission 040656-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3438 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 105480812-105820130 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105748401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 511 (P511L)
Ref Sequence ENSEMBL: ENSMUSP00000097904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330]
AlphaFold A2A690
Predicted Effect probably damaging
Transcript: ENSMUST00000100330
AA Change: P511L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: P511L

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Meta Mutation Damage Score 0.6066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,575,673 (GRCm39) noncoding transcript Het
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Ampd3 T C 7: 110,402,433 (GRCm39) I479T probably damaging Het
Aoah G A 13: 21,101,242 (GRCm39) R254K probably benign Het
Appbp2 T C 11: 85,088,966 (GRCm39) E358G probably damaging Het
Col6a5 A G 9: 105,752,991 (GRCm39) S2294P possibly damaging Het
Cux1 T C 5: 136,340,414 (GRCm39) E632G probably damaging Het
Cyp7a1 T C 4: 6,272,769 (GRCm39) N148S probably damaging Het
Dgkz A T 2: 91,764,395 (GRCm39) probably benign Het
Dlgap1 A T 17: 70,823,356 (GRCm39) S114C probably damaging Het
Dmtn T A 14: 70,850,156 (GRCm39) I263F probably damaging Het
Gigyf2 C A 1: 87,368,302 (GRCm39) H1029N probably damaging Het
Gm10770 T A 2: 150,021,469 (GRCm39) probably null Het
Gnb1l A G 16: 18,371,117 (GRCm39) T203A probably benign Het
Kng2 T C 16: 22,830,821 (GRCm39) I163V probably benign Het
Lamc1 T C 1: 153,102,161 (GRCm39) D1479G probably benign Het
Larp7-ps A C 4: 92,079,919 (GRCm39) V23G possibly damaging Het
Lhx4 T A 1: 155,578,230 (GRCm39) D304V probably benign Het
Mybl1 G T 1: 9,757,870 (GRCm39) T143K probably damaging Het
Notch3 C T 17: 32,372,564 (GRCm39) C630Y probably damaging Het
Oas1e T C 5: 120,933,475 (GRCm39) E30G probably damaging Het
Or4c114 T C 2: 88,904,707 (GRCm39) I243V probably benign Het
Or8b55 T G 9: 38,727,512 (GRCm39) F238V probably damaging Het
Or9e1 G T 11: 58,732,698 (GRCm39) G253* probably null Het
Otoa A G 7: 120,759,566 (GRCm39) E1056G possibly damaging Het
Plin4 A G 17: 56,414,193 (GRCm39) V144A probably benign Het
Sec16b T C 1: 157,384,328 (GRCm39) probably benign Het
Stk31 A G 6: 49,414,455 (GRCm39) S485G probably benign Het
Utrn T C 10: 12,357,062 (GRCm39) D309G probably damaging Het
Vpreb3 C T 10: 75,779,056 (GRCm39) probably benign Het
Vsx2 A T 12: 84,616,985 (GRCm39) Q90L probably damaging Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105,814,046 (GRCm39) missense probably benign 0.28
IGL00688:Tanc2 APN 11 105,689,516 (GRCm39) missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105,689,621 (GRCm39) missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105,515,891 (GRCm39) missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105,777,300 (GRCm39) splice site probably benign
IGL01386:Tanc2 APN 11 105,777,207 (GRCm39) missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105,701,348 (GRCm39) missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105,670,895 (GRCm39) missense probably benign 0.00
IGL01979:Tanc2 APN 11 105,667,746 (GRCm39) missense probably benign
IGL02104:Tanc2 APN 11 105,670,959 (GRCm39) unclassified probably benign
IGL02434:Tanc2 APN 11 105,670,868 (GRCm39) missense probably benign 0.14
IGL02534:Tanc2 APN 11 105,725,994 (GRCm39) missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105,667,777 (GRCm39) missense probably benign 0.00
IGL03279:Tanc2 APN 11 105,803,918 (GRCm39) splice site probably null
R0595:Tanc2 UTSW 11 105,605,003 (GRCm39) splice site probably null
R1131:Tanc2 UTSW 11 105,725,828 (GRCm39) missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105,777,270 (GRCm39) missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105,814,460 (GRCm39) missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105,812,963 (GRCm39) missense probably benign 0.21
R1692:Tanc2 UTSW 11 105,748,326 (GRCm39) missense probably benign
R1712:Tanc2 UTSW 11 105,790,606 (GRCm39) missense probably benign
R1793:Tanc2 UTSW 11 105,515,859 (GRCm39) critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105,777,212 (GRCm39) missense probably benign 0.01
R1905:Tanc2 UTSW 11 105,813,689 (GRCm39) missense possibly damaging 0.61
R1959:Tanc2 UTSW 11 105,801,121 (GRCm39) missense probably damaging 1.00
R1962:Tanc2 UTSW 11 105,689,558 (GRCm39) missense probably benign 0.14
R2122:Tanc2 UTSW 11 105,786,775 (GRCm39) missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105,801,135 (GRCm39) missense probably benign 0.00
R2341:Tanc2 UTSW 11 105,725,877 (GRCm39) missense probably benign 0.09
R2497:Tanc2 UTSW 11 105,564,319 (GRCm39) critical splice donor site probably null
R3711:Tanc2 UTSW 11 105,689,516 (GRCm39) missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105,805,796 (GRCm39) missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105,689,504 (GRCm39) missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105,804,888 (GRCm39) intron probably benign
R4609:Tanc2 UTSW 11 105,801,066 (GRCm39) missense probably benign 0.24
R4674:Tanc2 UTSW 11 105,758,306 (GRCm39) missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105,758,588 (GRCm39) missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105,515,886 (GRCm39) start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105,670,918 (GRCm39) missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105,748,379 (GRCm39) missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105,667,672 (GRCm39) missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105,758,311 (GRCm39) missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105,813,709 (GRCm39) missense probably benign 0.00
R5501:Tanc2 UTSW 11 105,805,811 (GRCm39) critical splice donor site probably null
R5590:Tanc2 UTSW 11 105,814,132 (GRCm39) missense probably damaging 0.99
R5651:Tanc2 UTSW 11 105,689,526 (GRCm39) missense probably benign 0.44
R5798:Tanc2 UTSW 11 105,812,681 (GRCm39) small deletion probably benign
R5876:Tanc2 UTSW 11 105,813,439 (GRCm39) missense possibly damaging 0.71
R5889:Tanc2 UTSW 11 105,812,633 (GRCm39) missense probably benign 0.23
R5958:Tanc2 UTSW 11 105,731,451 (GRCm39) missense probably benign 0.00
R5999:Tanc2 UTSW 11 105,758,543 (GRCm39) missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105,814,498 (GRCm39) missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105,758,543 (GRCm39) missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105,787,373 (GRCm39) missense possibly damaging 0.68
R6025:Tanc2 UTSW 11 105,758,543 (GRCm39) missense probably damaging 1.00
R6048:Tanc2 UTSW 11 105,758,543 (GRCm39) missense probably damaging 1.00
R6049:Tanc2 UTSW 11 105,758,543 (GRCm39) missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105,803,865 (GRCm39) missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105,748,382 (GRCm39) missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105,777,316 (GRCm39) splice site probably null
R6846:Tanc2 UTSW 11 105,689,479 (GRCm39) missense probably benign 0.34
R6857:Tanc2 UTSW 11 105,801,114 (GRCm39) missense possibly damaging 0.81
R6904:Tanc2 UTSW 11 105,726,056 (GRCm39) missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105,731,525 (GRCm39) missense possibly damaging 0.47
R7017:Tanc2 UTSW 11 105,813,934 (GRCm39) missense probably benign
R7371:Tanc2 UTSW 11 105,689,422 (GRCm39) missense probably benign
R7556:Tanc2 UTSW 11 105,799,857 (GRCm39) missense
R7630:Tanc2 UTSW 11 105,667,734 (GRCm39) missense probably benign 0.04
R7693:Tanc2 UTSW 11 105,814,293 (GRCm39) missense probably damaging 1.00
R7757:Tanc2 UTSW 11 105,667,684 (GRCm39) missense possibly damaging 0.81
R7807:Tanc2 UTSW 11 105,758,480 (GRCm39) missense probably benign 0.00
R7878:Tanc2 UTSW 11 105,804,241 (GRCm39) missense
R7895:Tanc2 UTSW 11 105,812,651 (GRCm39) missense probably damaging 1.00
R7952:Tanc2 UTSW 11 105,787,423 (GRCm39) missense probably damaging 1.00
R8099:Tanc2 UTSW 11 105,754,833 (GRCm39) missense probably benign 0.17
R8117:Tanc2 UTSW 11 105,725,988 (GRCm39) missense probably damaging 1.00
R8133:Tanc2 UTSW 11 105,814,048 (GRCm39) missense probably damaging 0.97
R8422:Tanc2 UTSW 11 105,726,014 (GRCm39) missense probably benign 0.10
R8527:Tanc2 UTSW 11 105,807,834 (GRCm39) missense probably damaging 0.96
R8542:Tanc2 UTSW 11 105,807,834 (GRCm39) missense probably damaging 0.96
R8834:Tanc2 UTSW 11 105,807,845 (GRCm39) missense
R8912:Tanc2 UTSW 11 105,758,153 (GRCm39) missense probably benign 0.01
R8927:Tanc2 UTSW 11 105,701,331 (GRCm39) missense probably damaging 0.99
R8928:Tanc2 UTSW 11 105,701,331 (GRCm39) missense probably damaging 0.99
R8968:Tanc2 UTSW 11 105,758,400 (GRCm39) missense possibly damaging 0.50
R9065:Tanc2 UTSW 11 105,689,518 (GRCm39) nonsense probably null
R9095:Tanc2 UTSW 11 105,758,104 (GRCm39) missense probably benign 0.00
R9108:Tanc2 UTSW 11 105,810,580 (GRCm39) intron probably benign
R9131:Tanc2 UTSW 11 105,689,603 (GRCm39) missense probably benign
R9294:Tanc2 UTSW 11 105,777,284 (GRCm39) missense probably damaging 0.99
R9445:Tanc2 UTSW 11 105,758,290 (GRCm39) missense possibly damaging 0.80
X0027:Tanc2 UTSW 11 105,726,009 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCTAATAAGCCTGTTTGCAATCTC -3'
(R):5'- CCAAGAAAAGTCTTCTGCATGC -3'

Sequencing Primer
(F):5'- CCATAGGTGGTTGCCTATCAC -3'
(R):5'- GCATGCTGTACTCTGTAGACATCAG -3'
Posted On 2015-02-18