Mutagenetix > Incidental Mutation

Incidental Mutation 'R3438:Dmtn'

267294

Institutional Source

Beutler Lab

Gene Symbol

Dmtn

Ensembl Gene

ENSMUSG00000022099

Gene Name

dematin actin binding protein

Synonyms

dematin, Epb4.9

MMRRC Submission

040656-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R3438 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70839624-70873488 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70850156 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 263 (I263F)

Ref Sequence

ENSEMBL: ENSMUSP00000153828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022694] [ENSMUST00000022695] [ENSMUST00000110984] [ENSMUST00000227331] [ENSMUST00000228001] [ENSMUST00000228009] [ENSMUST00000228824] [ENSMUST00000228295]

AlphaFold

Q9WV69

Predicted Effect

probably damaging
Transcript: ENSMUST00000022694
AA Change: I263F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000022694
Gene: ENSMUSG00000022099
AA Change: I263F

Domain	Start	End	E-Value	Type
Pfam:AbLIM_anchor	8	93	8e-30	PFAM
Pfam:AbLIM_anchor	79	347	1.9e-58	PFAM
VHP	348	383	1.88e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022695
AA Change: I238F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022695
Gene: ENSMUSG00000022099
AA Change: I238F

Domain	Start	End	E-Value	Type
low complexity region	60	72	N/A	INTRINSIC
low complexity region	88	99	N/A	INTRINSIC
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	188	220	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
VHP	345	380	1.88e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110984
AA Change: I263F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106612
Gene: ENSMUSG00000022099
AA Change: I263F

Domain	Start	End	E-Value	Type
low complexity region	11	29	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
low complexity region	113	124	N/A	INTRINSIC
low complexity region	174	185	N/A	INTRINSIC
coiled coil region	213	245	N/A	INTRINSIC
low complexity region	277	292	N/A	INTRINSIC
VHP	348	383	1.88e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227453

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228001
AA Change: I238F

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228009
AA Change: I263F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228824
AA Change: I238F

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228295
AA Change: I238F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.0633

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a targeted mutation display mild anemia and spherocytosis. Mutant erythrocytes are osmotically fragile and show reduced deformability and filterability as well as increased membrane fragmentation and selective loss of spectrin and actin from RBC membrane skeletons and vesicles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017G19Rik	A	G	3: 40,575,673 (GRCm39)		noncoding transcript	Het
A2ml1	C	T	6: 128,557,349 (GRCm39)	A115T	probably benign	Het
Ampd3	T	C	7: 110,402,433 (GRCm39)	I479T	probably damaging	Het
Aoah	G	A	13: 21,101,242 (GRCm39)	R254K	probably benign	Het
Appbp2	T	C	11: 85,088,966 (GRCm39)	E358G	probably damaging	Het
Col6a5	A	G	9: 105,752,991 (GRCm39)	S2294P	possibly damaging	Het
Cux1	T	C	5: 136,340,414 (GRCm39)	E632G	probably damaging	Het
Cyp7a1	T	C	4: 6,272,769 (GRCm39)	N148S	probably damaging	Het
Dgkz	A	T	2: 91,764,395 (GRCm39)		probably benign	Het
Dlgap1	A	T	17: 70,823,356 (GRCm39)	S114C	probably damaging	Het
Gigyf2	C	A	1: 87,368,302 (GRCm39)	H1029N	probably damaging	Het
Gm10770	T	A	2: 150,021,469 (GRCm39)		probably null	Het
Gnb1l	A	G	16: 18,371,117 (GRCm39)	T203A	probably benign	Het
Kng2	T	C	16: 22,830,821 (GRCm39)	I163V	probably benign	Het
Lamc1	T	C	1: 153,102,161 (GRCm39)	D1479G	probably benign	Het
Larp7-ps	A	C	4: 92,079,919 (GRCm39)	V23G	possibly damaging	Het
Lhx4	T	A	1: 155,578,230 (GRCm39)	D304V	probably benign	Het
Mybl1	G	T	1: 9,757,870 (GRCm39)	T143K	probably damaging	Het
Notch3	C	T	17: 32,372,564 (GRCm39)	C630Y	probably damaging	Het
Oas1e	T	C	5: 120,933,475 (GRCm39)	E30G	probably damaging	Het
Or4c114	T	C	2: 88,904,707 (GRCm39)	I243V	probably benign	Het
Or8b55	T	G	9: 38,727,512 (GRCm39)	F238V	probably damaging	Het
Or9e1	G	T	11: 58,732,698 (GRCm39)	G253*	probably null	Het
Otoa	A	G	7: 120,759,566 (GRCm39)	E1056G	possibly damaging	Het
Plin4	A	G	17: 56,414,193 (GRCm39)	V144A	probably benign	Het
Sec16b	T	C	1: 157,384,328 (GRCm39)		probably benign	Het
Stk31	A	G	6: 49,414,455 (GRCm39)	S485G	probably benign	Het
Tanc2	C	T	11: 105,748,401 (GRCm39)	P511L	probably damaging	Het
Utrn	T	C	10: 12,357,062 (GRCm39)	D309G	probably damaging	Het
Vpreb3	C	T	10: 75,779,056 (GRCm39)		probably benign	Het
Vsx2	A	T	12: 84,616,985 (GRCm39)	Q90L	probably damaging	Het

Other mutations in Dmtn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01802:Dmtn	APN	14	70,842,259 (GRCm39)	missense	probably damaging	1.00
IGL02836:Dmtn	APN	14	70,853,518 (GRCm39)	missense	probably damaging	1.00
R1248:Dmtn	UTSW	14	70,850,098 (GRCm39)	splice site	probably benign
R2428:Dmtn	UTSW	14	70,850,843 (GRCm39)	missense	probably damaging	1.00
R4851:Dmtn	UTSW	14	70,842,254 (GRCm39)	missense	probably damaging	1.00
R4917:Dmtn	UTSW	14	70,843,159 (GRCm39)	missense	probably damaging	0.98
R4924:Dmtn	UTSW	14	70,855,399 (GRCm39)	missense	probably benign	0.25
R5633:Dmtn	UTSW	14	70,842,419 (GRCm39)	missense	probably benign	0.18
R6170:Dmtn	UTSW	14	70,854,795 (GRCm39)	missense	probably damaging	1.00
R6214:Dmtn	UTSW	14	70,850,776 (GRCm39)	missense	probably benign	0.05
R6215:Dmtn	UTSW	14	70,850,776 (GRCm39)	missense	probably benign	0.05
R6639:Dmtn	UTSW	14	70,854,870 (GRCm39)	missense	probably damaging	1.00
R6860:Dmtn	UTSW	14	70,852,322 (GRCm39)	missense	possibly damaging	0.94
R7139:Dmtn	UTSW	14	70,854,867 (GRCm39)	missense	probably benign	0.12
R7242:Dmtn	UTSW	14	70,855,460 (GRCm39)	missense	probably damaging	1.00
R7380:Dmtn	UTSW	14	70,854,768 (GRCm39)	missense	probably damaging	0.99
R7572:Dmtn	UTSW	14	70,842,777 (GRCm39)	missense	possibly damaging	0.93
R8806:Dmtn	UTSW	14	70,852,388 (GRCm39)	missense	probably benign	0.26
R8888:Dmtn	UTSW	14	70,850,144 (GRCm39)	missense	probably benign	0.18
R8895:Dmtn	UTSW	14	70,850,144 (GRCm39)	missense	probably benign	0.18
R9027:Dmtn	UTSW	14	70,853,555 (GRCm39)	missense	probably damaging	0.99
R9032:Dmtn	UTSW	14	70,853,534 (GRCm39)	missense	probably damaging	0.99
R9085:Dmtn	UTSW	14	70,853,534 (GRCm39)	missense	probably damaging	0.99
R9694:Dmtn	UTSW	14	70,852,732 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCCTAAAGGAGTACACCTGTGG -3'
(R):5'- TGCTTGAGTGCCCAGTAAGATC -3'

Sequencing Primer
(F):5'- AGTACACCTGTGGGCCTCAC -3'
(R):5'- TGCCCAGTAAGATCAACGG -3'

Posted On

2015-02-18