Incidental Mutation 'R3439:Or4f58'
ID 267304
Institutional Source Beutler Lab
Gene Symbol Or4f58
Ensembl Gene ENSMUSG00000109403
Gene Name olfactory receptor family 4 subfamily F member 58
Synonyms MOR245-21, GA_x6K02T2Q125-73069292-73068354, Olfr1311
MMRRC Submission 040657-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R3439 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 111851259-111852197 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111851792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 136 (M136V)
Ref Sequence ENSEMBL: ENSMUSP00000150617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208536] [ENSMUST00000213602] [ENSMUST00000215321]
AlphaFold Q8VET0
Predicted Effect possibly damaging
Transcript: ENSMUST00000099601
AA Change: M136V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097196
Gene: ENSMUSG00000074948
AA Change: M136V

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.9e-43 PFAM
Pfam:7tm_1 41 287 3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208536
AA Change: M136V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213602
AA Change: M136V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215321
AA Change: M136V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216319
Meta Mutation Damage Score 0.1121 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 C A 15: 10,381,511 (GRCm39) P255Q probably benign Het
Cdcp3 T C 7: 130,790,508 (GRCm39) probably null Het
Dnah10 T C 5: 124,873,322 (GRCm39) Y2458H possibly damaging Het
Dnhd1 A G 7: 105,343,992 (GRCm39) T1779A probably damaging Het
Glb1l A T 1: 75,179,264 (GRCm39) C222S probably damaging Het
Gnb1l A G 16: 18,371,117 (GRCm39) T203A probably benign Het
Helq T C 5: 100,946,170 (GRCm39) E57G probably damaging Het
Kng2 T C 16: 22,830,821 (GRCm39) I163V probably benign Het
Larp7-ps A C 4: 92,079,919 (GRCm39) V23G possibly damaging Het
Lingo1 T C 9: 56,528,017 (GRCm39) T191A probably benign Het
Lrrc37a G A 11: 103,388,690 (GRCm39) T2245I unknown Het
Med13 T C 11: 86,176,123 (GRCm39) D1624G probably damaging Het
Mthfsd A G 8: 121,825,860 (GRCm39) V218A possibly damaging Het
Naip1 A T 13: 100,559,727 (GRCm39) D1092E probably benign Het
Nom1 T C 5: 29,640,615 (GRCm39) S314P probably benign Het
Nwd2 G A 5: 63,961,895 (GRCm39) R493H probably benign Het
Or5an11 A T 19: 12,245,759 (GRCm39) H55L possibly damaging Het
Palm C T 10: 79,652,618 (GRCm39) probably benign Het
Pitpnm1 A G 19: 4,162,752 (GRCm39) E1115G probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Prrc2b T C 2: 32,096,359 (GRCm39) F577L probably benign Het
Rnpepl1 A T 1: 92,844,662 (GRCm39) T385S possibly damaging Het
Serpinb7 A T 1: 107,356,081 (GRCm39) I35F probably damaging Het
Srbd1 C T 17: 86,365,187 (GRCm39) S623N probably benign Het
Tchh A G 3: 93,354,700 (GRCm39) E1380G unknown Het
Tet2 G T 3: 133,172,592 (GRCm39) A1890D possibly damaging Het
Tfr2 G T 5: 137,572,913 (GRCm39) V215F probably benign Het
Vpreb3 C T 10: 75,779,056 (GRCm39) probably benign Het
Vwde T A 6: 13,208,374 (GRCm39) L169F probably damaging Het
Other mutations in Or4f58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Or4f58 APN 2 111,851,477 (GRCm39) missense probably damaging 1.00
IGL02626:Or4f58 APN 2 111,851,458 (GRCm39) missense probably damaging 1.00
R0499:Or4f58 UTSW 2 111,851,777 (GRCm39) missense probably damaging 1.00
R1511:Or4f58 UTSW 2 111,851,749 (GRCm39) missense probably benign 0.00
R4564:Or4f58 UTSW 2 111,852,112 (GRCm39) missense possibly damaging 0.80
R4756:Or4f58 UTSW 2 111,851,332 (GRCm39) missense possibly damaging 0.52
R4776:Or4f58 UTSW 2 111,851,276 (GRCm39) missense probably benign 0.01
R5777:Or4f58 UTSW 2 111,851,876 (GRCm39) missense probably damaging 1.00
R5936:Or4f58 UTSW 2 111,851,932 (GRCm39) missense probably benign 0.38
R6283:Or4f58 UTSW 2 111,851,605 (GRCm39) missense possibly damaging 0.91
R6368:Or4f58 UTSW 2 111,851,896 (GRCm39) missense probably damaging 0.99
R6484:Or4f58 UTSW 2 111,851,764 (GRCm39) nonsense probably null
R7373:Or4f58 UTSW 2 111,851,787 (GRCm39) missense probably benign
R9223:Or4f58 UTSW 2 111,851,517 (GRCm39) missense possibly damaging 0.78
X0065:Or4f58 UTSW 2 111,851,980 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCCACTGTTGGCTGTGAC -3'
(R):5'- GAGTTTGCTCTATTGCAGCAC -3'

Sequencing Primer
(F):5'- TTGGCTGTGACCATGAACAC -3'
(R):5'- GCAGCACCCAAGATGATTTTTGAC -3'
Posted On 2015-02-18