Incidental Mutation 'R3439:Olfr1311'
ID267304
Institutional Source Beutler Lab
Gene Symbol Olfr1311
Ensembl Gene ENSMUSG00000109403
Gene Nameolfactory receptor 1311
SynonymsGA_x6K02T2Q125-73069292-73068354, MOR245-21
MMRRC Submission 040657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R3439 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112019656-112024412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112021447 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 136 (M136V)
Ref Sequence ENSEMBL: ENSMUSP00000150617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208536] [ENSMUST00000213602] [ENSMUST00000215321]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099601
AA Change: M136V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097196
Gene: ENSMUSG00000074948
AA Change: M136V

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.9e-43 PFAM
Pfam:7tm_1 41 287 3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208536
AA Change: M136V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213602
AA Change: M136V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215321
AA Change: M136V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216319
Meta Mutation Damage Score 0.1121 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Gnb1l A G 16: 18,552,367 T203A probably benign Het
Helq T C 5: 100,798,304 E57G probably damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Palm C T 10: 79,816,784 probably benign Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Rnpepl1 A T 1: 92,916,940 T385S possibly damaging Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Srbd1 C T 17: 86,057,759 S623N probably benign Het
Tchh A G 3: 93,447,393 E1380G unknown Het
Tet2 G T 3: 133,466,831 A1890D possibly damaging Het
Tfr2 G T 5: 137,574,651 V215F probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Olfr1311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1311 APN 2 112021132 missense probably damaging 1.00
IGL02626:Olfr1311 APN 2 112021113 missense probably damaging 1.00
R0499:Olfr1311 UTSW 2 112021432 missense probably damaging 1.00
R1511:Olfr1311 UTSW 2 112021404 missense probably benign 0.00
R4564:Olfr1311 UTSW 2 112021767 missense possibly damaging 0.80
R4756:Olfr1311 UTSW 2 112020987 missense possibly damaging 0.52
R4776:Olfr1311 UTSW 2 112020931 missense probably benign 0.01
R5777:Olfr1311 UTSW 2 112021531 missense probably damaging 1.00
R5936:Olfr1311 UTSW 2 112021587 missense probably benign 0.38
R6283:Olfr1311 UTSW 2 112021260 missense possibly damaging 0.91
R6368:Olfr1311 UTSW 2 112021551 missense probably damaging 0.99
R6484:Olfr1311 UTSW 2 112021419 nonsense probably null
R7373:Olfr1311 UTSW 2 112021442 missense probably benign
X0065:Olfr1311 UTSW 2 112021635 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCCACTGTTGGCTGTGAC -3'
(R):5'- GAGTTTGCTCTATTGCAGCAC -3'

Sequencing Primer
(F):5'- TTGGCTGTGACCATGAACAC -3'
(R):5'- GCAGCACCCAAGATGATTTTTGAC -3'
Posted On2015-02-18