Incidental Mutation 'R3439:Gnb1l'
ID267329
Institutional Source Beutler Lab
Gene Symbol Gnb1l
Ensembl Gene ENSMUSG00000000884
Gene Nameguanine nucleotide binding protein (G protein), beta polypeptide 1-like
SynonymsESTM55, Wdvcf, Wdr14, Me49f07
MMRRC Submission 040657-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R3439 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18498713-18566679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18552367 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 203 (T203A)
Ref Sequence ENSEMBL: ENSMUSP00000130371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000904] [ENSMUST00000090086] [ENSMUST00000115600] [ENSMUST00000115601] [ENSMUST00000139625] [ENSMUST00000149035] [ENSMUST00000167778] [ENSMUST00000231621]
Predicted Effect probably benign
Transcript: ENSMUST00000000904
SMART Domains Protein: ENSMUSP00000000904
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 112 143 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000090086
AA Change: T172A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087544
Gene: ENSMUSG00000000884
AA Change: T172A

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
WD40 146 193 9.17e1 SMART
WD40 196 235 4.79e-1 SMART
WD40 238 280 4.79e-1 SMART
WD40 283 321 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115600
SMART Domains Protein: ENSMUSP00000111263
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 136 188 3e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115601
SMART Domains Protein: ENSMUSP00000111264
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 138 179 1e-16 BLAST
WD40 182 221 4.79e-1 SMART
WD40 224 266 4.79e-1 SMART
WD40 269 307 6.04e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129952
Predicted Effect probably benign
Transcript: ENSMUST00000139625
AA Change: T69A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120897
Gene: ENSMUSG00000000884
AA Change: T69A

DomainStartEndE-ValueType
Blast:WD40 35 75 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149035
SMART Domains Protein: ENSMUSP00000114875
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
Blast:WD40 35 76 8e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151253
Predicted Effect probably benign
Transcript: ENSMUST00000167778
AA Change: T203A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130371
Gene: ENSMUSG00000000884
AA Change: T203A

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
WD40 146 193 9.17e1 SMART
WD40 196 235 4.79e-1 SMART
WD40 238 280 4.79e-1 SMART
WD40 283 321 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231621
AA Change: T172A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232235
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a gene trapped allele exhibit significantly reduced prepulse inhibition. Homozygotes die during early gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,188,779 probably null Het
Agxt2 C A 15: 10,381,425 P255Q probably benign Het
Dnah10 T C 5: 124,796,258 Y2458H possibly damaging Het
Dnhd1 A G 7: 105,694,785 T1779A probably damaging Het
Glb1l A T 1: 75,202,620 C222S probably damaging Het
Gm12666 A C 4: 92,191,682 V23G possibly damaging Het
Helq T C 5: 100,798,304 E57G probably damaging Het
Kng2 T C 16: 23,012,071 I163V probably benign Het
Lingo1 T C 9: 56,620,733 T191A probably benign Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Med13 T C 11: 86,285,297 D1624G probably damaging Het
Mthfsd A G 8: 121,099,121 V218A possibly damaging Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nom1 T C 5: 29,435,617 S314P probably benign Het
Nwd2 G A 5: 63,804,552 R493H probably benign Het
Olfr1311 T C 2: 112,021,447 M136V possibly damaging Het
Olfr235 A T 19: 12,268,395 H55L possibly damaging Het
Palm C T 10: 79,816,784 probably benign Het
Pitpnm1 A G 19: 4,112,752 E1115G probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prrc2b T C 2: 32,206,347 F577L probably benign Het
Rnpepl1 A T 1: 92,916,940 T385S possibly damaging Het
Serpinb7 A T 1: 107,428,351 I35F probably damaging Het
Srbd1 C T 17: 86,057,759 S623N probably benign Het
Tchh A G 3: 93,447,393 E1380G unknown Het
Tet2 G T 3: 133,466,831 A1890D possibly damaging Het
Tfr2 G T 5: 137,574,651 V215F probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwde T A 6: 13,208,375 L169F probably damaging Het
Other mutations in Gnb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Gnb1l APN 16 18544200 missense probably damaging 1.00
IGL02860:Gnb1l APN 16 18552535 missense probably damaging 0.99
IGL03155:Gnb1l APN 16 18540532 splice site probably null
IGL03169:Gnb1l APN 16 18540455 missense probably damaging 1.00
R0017:Gnb1l UTSW 16 18541060 missense probably damaging 1.00
R0267:Gnb1l UTSW 16 18548089 splice site probably benign
R0365:Gnb1l UTSW 16 18552461 missense possibly damaging 0.95
R0845:Gnb1l UTSW 16 18552473 missense probably benign 0.01
R2975:Gnb1l UTSW 16 18564266 missense probably damaging 1.00
R3438:Gnb1l UTSW 16 18552367 missense probably benign 0.01
R4650:Gnb1l UTSW 16 18544275 critical splice donor site probably null
R4776:Gnb1l UTSW 16 18548096 nonsense probably null
R7135:Gnb1l UTSW 16 18545168 missense probably benign 0.05
R7290:Gnb1l UTSW 16 18564056 missense probably benign 0.37
R7488:Gnb1l UTSW 16 18540470 missense possibly damaging 0.90
R8195:Gnb1l UTSW 16 18544215 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGGTACTAAGCAGTGGCCCTAG -3'
(R):5'- TGATCGTCCAGACTCCAGACAG -3'

Sequencing Primer
(F):5'- CTAGGAGCCCCATGAGAGG -3'
(R):5'- GCCAGTACCTTCCCAGCAGAG -3'
Posted On2015-02-18