Incidental Mutation 'R3440:Abtb2'
ID 267338
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB domain containing 2
Synonyms BPOZ-2
MMRRC Submission 040658-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3440 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 103396655-103548768 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 103397577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 169 (A169E)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect probably benign
Transcript: ENSMUST00000076212
AA Change: A169E

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: A169E

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Meta Mutation Damage Score 0.1098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (29/30)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 25,170,759 (GRCm39) probably benign Het
Agmo C T 12: 37,293,799 (GRCm39) T74I probably damaging Het
Ano6 T C 15: 95,865,602 (GRCm39) V862A probably damaging Het
Bltp1 C T 3: 37,096,061 (GRCm39) Q4614* probably null Het
Cavin2 T A 1: 51,340,565 (GRCm39) V414E probably damaging Het
Clrn3 A C 7: 135,115,854 (GRCm39) Y165* probably null Het
Cp A T 3: 20,029,121 (GRCm39) M533L probably benign Het
Dhrs3 T A 4: 144,646,628 (GRCm39) M226K probably damaging Het
Fignl2 A G 15: 100,951,004 (GRCm39) F426S unknown Het
Fpr1 C T 17: 18,097,420 (GRCm39) D190N probably benign Het
Grik3 C A 4: 125,587,763 (GRCm39) L628M probably damaging Het
Grik3 T A 4: 125,587,764 (GRCm39) L628Q probably damaging Het
Grin2c T A 11: 115,141,469 (GRCm39) D883V probably damaging Het
Gtf3c6 T A 10: 40,127,169 (GRCm39) E123V probably null Het
H2-Eb1 A G 17: 34,528,655 (GRCm39) E62G probably damaging Het
Kif1a C T 1: 92,964,575 (GRCm39) D1334N possibly damaging Het
Lef1 A G 3: 130,978,407 (GRCm39) D175G probably damaging Het
Myom1 A G 17: 71,352,658 (GRCm39) probably null Het
Or6k2 A T 1: 173,986,746 (GRCm39) M136L probably benign Het
Pgr A T 9: 8,922,630 (GRCm39) N600I probably damaging Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Selp T C 1: 163,951,344 (GRCm39) F26S probably benign Het
Tchh A T 3: 93,352,414 (GRCm39) D618V unknown Het
Tenm4 A T 7: 96,202,723 (GRCm39) M88L probably benign Het
Zfat A T 15: 67,956,402 (GRCm39) D1143E probably benign Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103,535,463 (GRCm39) missense probably benign 0.00
IGL02605:Abtb2 APN 2 103,547,602 (GRCm39) missense probably benign
IGL03161:Abtb2 APN 2 103,397,799 (GRCm39) missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103,547,537 (GRCm39) nonsense probably null
R0147:Abtb2 UTSW 2 103,397,480 (GRCm39) missense probably benign 0.04
R1052:Abtb2 UTSW 2 103,535,417 (GRCm39) missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103,539,765 (GRCm39) missense probably benign 0.00
R1518:Abtb2 UTSW 2 103,539,629 (GRCm39) missense probably benign 0.03
R1650:Abtb2 UTSW 2 103,532,747 (GRCm39) missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103,397,369 (GRCm39) missense probably benign 0.00
R2054:Abtb2 UTSW 2 103,535,462 (GRCm39) missense probably benign 0.41
R2101:Abtb2 UTSW 2 103,397,207 (GRCm39) missense probably benign 0.05
R2363:Abtb2 UTSW 2 103,397,528 (GRCm39) missense probably damaging 1.00
R3927:Abtb2 UTSW 2 103,538,563 (GRCm39) splice site probably null
R4351:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103,547,644 (GRCm39) missense probably benign 0.35
R4814:Abtb2 UTSW 2 103,547,632 (GRCm39) missense probably benign 0.08
R4831:Abtb2 UTSW 2 103,513,820 (GRCm39) missense probably benign 0.06
R4900:Abtb2 UTSW 2 103,397,349 (GRCm39) missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103,397,408 (GRCm39) missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103,539,623 (GRCm39) critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103,532,655 (GRCm39) missense probably benign 0.00
R6298:Abtb2 UTSW 2 103,539,833 (GRCm39) missense probably benign 0.10
R6383:Abtb2 UTSW 2 103,397,721 (GRCm39) missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103,539,770 (GRCm39) nonsense probably null
R7000:Abtb2 UTSW 2 103,542,787 (GRCm39) missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103,545,860 (GRCm39) missense probably benign 0.20
R7176:Abtb2 UTSW 2 103,539,720 (GRCm39) missense probably benign 0.00
R7189:Abtb2 UTSW 2 103,397,861 (GRCm39) missense probably benign 0.00
R7199:Abtb2 UTSW 2 103,397,565 (GRCm39) missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103,532,769 (GRCm39) splice site probably null
R7347:Abtb2 UTSW 2 103,397,757 (GRCm39) missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103,397,292 (GRCm39) missense probably benign 0.00
R7629:Abtb2 UTSW 2 103,513,838 (GRCm39) critical splice donor site probably null
R7862:Abtb2 UTSW 2 103,532,626 (GRCm39) missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103,531,162 (GRCm39) missense probably benign 0.02
R8682:Abtb2 UTSW 2 103,397,720 (GRCm39) missense probably benign 0.36
R8700:Abtb2 UTSW 2 103,397,289 (GRCm39) missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103,541,829 (GRCm39) missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103,513,647 (GRCm39) missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103,541,580 (GRCm39) missense probably benign 0.00
R9258:Abtb2 UTSW 2 103,546,410 (GRCm39) missense probably null 0.99
R9343:Abtb2 UTSW 2 103,547,505 (GRCm39) missense probably benign
R9427:Abtb2 UTSW 2 103,531,244 (GRCm39) missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103,538,532 (GRCm39) missense probably benign
Z1176:Abtb2 UTSW 2 103,538,517 (GRCm39) nonsense probably null
Z1177:Abtb2 UTSW 2 103,541,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCCGGCTCCATGAACAG -3'
(R):5'- TCTCCATGCAAGCCGTTAG -3'

Sequencing Primer
(F):5'- CACGGTGAACACAGTGCTG -3'
(R):5'- AGATGGCCGCGTACTCATG -3'
Posted On 2015-02-18