Mutagenetix > Incidental Mutation

Incidental Mutation 'R3440:Abtb2'

267338

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

040658-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3440 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 103567232 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 169 (A169E)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

probably benign
Transcript: ENSMUST00000076212
AA Change: A169E

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: A169E

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Meta Mutation Damage Score

0.1098

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

97% (29/30)

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,041,912	Q4614*	probably null	Het
Adam3	T	C	8: 24,680,743		probably benign	Het
Agmo	C	T	12: 37,243,800	T74I	probably damaging	Het
Ano6	T	C	15: 95,967,721	V862A	probably damaging	Het
Cavin2	T	A	1: 51,301,406	V414E	probably damaging	Het
Clrn3	A	C	7: 135,514,125	Y165*	probably null	Het
Cp	A	T	3: 19,974,957	M533L	probably benign	Het
Dhrs3	T	A	4: 144,920,058	M226K	probably damaging	Het
Fignl2	A	G	15: 101,053,123	F426S	unknown	Het
Fpr1	C	T	17: 17,877,158	D190N	probably benign	Het
Grik3	C	A	4: 125,693,970	L628M	probably damaging	Het
Grik3	T	A	4: 125,693,971	L628Q	probably damaging	Het
Grin2c	T	A	11: 115,250,643	D883V	probably damaging	Het
Gtf3c6	T	A	10: 40,251,173	E123V	probably null	Het
H2-Eb1	A	G	17: 34,309,681	E62G	probably damaging	Het
Kif1a	C	T	1: 93,036,853	D1334N	possibly damaging	Het
Lef1	A	G	3: 131,184,758	D175G	probably damaging	Het
Myom1	A	G	17: 71,045,663		probably null	Het
Olfr420	A	T	1: 174,159,180	M136L	probably benign	Het
Pgr	A	T	9: 8,922,629	N600I	probably damaging	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Selp	T	C	1: 164,123,775	F26S	probably benign	Het
Tchh	A	T	3: 93,445,107	D618V	unknown	Het
Tenm4	A	T	7: 96,553,516	M88L	probably benign	Het
Zfat	A	T	15: 68,084,553	D1143E	probably benign	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTCCGGCTCCATGAACAG -3'
(R):5'- TCTCCATGCAAGCCGTTAG -3'

Sequencing Primer
(F):5'- CACGGTGAACACAGTGCTG -3'
(R):5'- AGATGGCCGCGTACTCATG -3'

Posted On

2015-02-18