Incidental Mutation 'R3440:Dhrs3'
ID267345
Institutional Source Beutler Lab
Gene Symbol Dhrs3
Ensembl Gene ENSMUSG00000066026
Gene Namedehydrogenase/reductase (SDR family) member 3
SynonymsRsdr1, retSDR1
MMRRC Submission 040658-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3440 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144892827-144928209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144920058 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 226 (M226K)
Ref Sequence ENSEMBL: ENSMUSP00000122552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084184] [ENSMUST00000105744] [ENSMUST00000142808] [ENSMUST00000154208] [ENSMUST00000171001]
Predicted Effect probably benign
Transcript: ENSMUST00000084184
SMART Domains Protein: ENSMUSP00000081200
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 39 121 1.7e-19 PFAM
Pfam:KR 40 119 1.5e-16 PFAM
Pfam:Polysacc_synt_2 41 121 1.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105744
AA Change: M160K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101370
Gene: ENSMUSG00000066026
AA Change: M160K

DomainStartEndE-ValueType
Pfam:adh_short 13 92 2.1e-18 PFAM
Pfam:KR 14 93 1.5e-15 PFAM
Pfam:Polysacc_synt_2 15 90 4.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133265
Predicted Effect probably benign
Transcript: ENSMUST00000142808
SMART Domains Protein: ENSMUSP00000122578
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 13 146 6.1e-29 PFAM
Pfam:KR 14 139 5.9e-20 PFAM
Pfam:Polysacc_synt_2 15 109 4.2e-10 PFAM
Pfam:Epimerase 15 124 3.8e-8 PFAM
Pfam:adh_short_C2 19 146 3.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154208
AA Change: M226K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122552
Gene: ENSMUSG00000066026
AA Change: M226K

DomainStartEndE-ValueType
Pfam:adh_short 39 233 7.8e-42 PFAM
Pfam:KR 40 213 2.3e-21 PFAM
Pfam:Polysacc_synt_2 41 132 2.8e-9 PFAM
Pfam:adh_short_C2 45 205 4.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171001
AA Change: M200K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126154
Gene: ENSMUSG00000066026
AA Change: M200K

DomainStartEndE-ValueType
Pfam:adh_short 13 181 2.1e-34 PFAM
Pfam:KR 14 191 2.7e-21 PFAM
Pfam:Polysacc_synt_2 15 106 1.8e-9 PFAM
Pfam:Epimerase 15 124 2e-7 PFAM
Pfam:adh_short_C2 19 179 2e-14 PFAM
Meta Mutation Damage Score 0.9630 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short-chain dehydrogenases/reductases (SDRs), such as DHRS3, catalyze the oxidation/reduction of a wide range of substrates, including retinoids and steroids (Haeseleer and Palczewski, 2000 [PubMed 10800688]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a targeted mutation die before weaning age. Mice homozygous for a gene trap allele exhibit perinatal lethality, altered retinoid metabolism and heart, craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,041,912 Q4614* probably null Het
Abtb2 C A 2: 103,567,232 A169E probably benign Het
Adam3 T C 8: 24,680,743 probably benign Het
Agmo C T 12: 37,243,800 T74I probably damaging Het
Ano6 T C 15: 95,967,721 V862A probably damaging Het
Cavin2 T A 1: 51,301,406 V414E probably damaging Het
Clrn3 A C 7: 135,514,125 Y165* probably null Het
Cp A T 3: 19,974,957 M533L probably benign Het
Fignl2 A G 15: 101,053,123 F426S unknown Het
Fpr1 C T 17: 17,877,158 D190N probably benign Het
Grik3 C A 4: 125,693,970 L628M probably damaging Het
Grik3 T A 4: 125,693,971 L628Q probably damaging Het
Grin2c T A 11: 115,250,643 D883V probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
H2-Eb1 A G 17: 34,309,681 E62G probably damaging Het
Kif1a C T 1: 93,036,853 D1334N possibly damaging Het
Lef1 A G 3: 131,184,758 D175G probably damaging Het
Myom1 A G 17: 71,045,663 probably null Het
Olfr420 A T 1: 174,159,180 M136L probably benign Het
Pgr A T 9: 8,922,629 N600I probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Selp T C 1: 164,123,775 F26S probably benign Het
Tchh A T 3: 93,445,107 D618V unknown Het
Tenm4 A T 7: 96,553,516 M88L probably benign Het
Zfat A T 15: 68,084,553 D1143E probably benign Het
Other mutations in Dhrs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Dhrs3 APN 4 144919472 missense probably damaging 0.96
IGL02226:Dhrs3 APN 4 144923949 missense possibly damaging 0.94
IGL02236:Dhrs3 APN 4 144893563 missense probably benign
IGL02728:Dhrs3 APN 4 144920072 missense probably damaging 0.98
R0079:Dhrs3 UTSW 4 144920048 missense probably damaging 0.99
R0734:Dhrs3 UTSW 4 144927176 missense probably damaging 0.99
R1474:Dhrs3 UTSW 4 144919487 missense probably damaging 1.00
R1632:Dhrs3 UTSW 4 144893546 missense probably benign 0.30
R2010:Dhrs3 UTSW 4 144927188 missense possibly damaging 0.49
R3162:Dhrs3 UTSW 4 144919446 missense possibly damaging 0.80
R3162:Dhrs3 UTSW 4 144919446 missense possibly damaging 0.80
R3176:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R3276:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R3709:Dhrs3 UTSW 4 144893711 critical splice donor site probably null
R3795:Dhrs3 UTSW 4 144919392 missense probably damaging 0.99
R5571:Dhrs3 UTSW 4 144893564 missense probably benign 0.34
R5943:Dhrs3 UTSW 4 144919976 missense possibly damaging 0.88
R6457:Dhrs3 UTSW 4 144919952 missense probably damaging 1.00
R7607:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R8144:Dhrs3 UTSW 4 144919904 missense probably damaging 1.00
R8371:Dhrs3 UTSW 4 144919383 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTGTGCCTCAATTCCGTG -3'
(R):5'- CTGTACTAAGAAGCAGGACCC -3'

Sequencing Primer
(F):5'- AATTCCGTGCTTGCACTGTCAG -3'
(R):5'- GATGCAATGTGACCATCTGC -3'
Posted On2015-02-18