Incidental Mutation 'R3440:Agmo'
ID267358
Institutional Source Beutler Lab
Gene Symbol Agmo
Ensembl Gene ENSMUSG00000050103
Gene Namealkylglycerol monooxygenase
SynonymsA530016O06Rik, Tmem195
MMRRC Submission 040658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R3440 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location37241641-37582202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37243800 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 74 (T74I)
Ref Sequence ENSEMBL: ENSMUSP00000124044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049874] [ENSMUST00000159998] [ENSMUST00000160390] [ENSMUST00000160768]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049874
AA Change: T74I

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051441
Gene: ENSMUSG00000050103
AA Change: T74I

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 249 2.5e-29 PFAM
transmembrane domain 364 383 N/A INTRINSIC
transmembrane domain 411 433 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159998
AA Change: T74I

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123801
Gene: ENSMUSG00000050103
AA Change: T74I

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160158
Predicted Effect possibly damaging
Transcript: ENSMUST00000160390
AA Change: T74I

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125639
Gene: ENSMUSG00000050103
AA Change: T74I

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7.1e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160768
AA Change: T74I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124044
Gene: ENSMUSG00000050103
AA Change: T74I

DomainStartEndE-ValueType
transmembrane domain 43 61 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrahydrobiopterin- and iron-dependent enzyme that cleaves the ether bond of alkylglycerols. Sequence comparisons distinguish this protein as forming a third, distinct class of tetrahydrobiopterin-dependent enzymes. Variations in this gene have been associated with decreased glucose-stimulated insulin response, type 2 diabetes, and susceptibility to intracranial aneurysms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,041,912 Q4614* probably null Het
Abtb2 C A 2: 103,567,232 A169E probably benign Het
Adam3 T C 8: 24,680,743 probably benign Het
Ano6 T C 15: 95,967,721 V862A probably damaging Het
Cavin2 T A 1: 51,301,406 V414E probably damaging Het
Clrn3 A C 7: 135,514,125 Y165* probably null Het
Cp A T 3: 19,974,957 M533L probably benign Het
Dhrs3 T A 4: 144,920,058 M226K probably damaging Het
Fignl2 A G 15: 101,053,123 F426S unknown Het
Fpr1 C T 17: 17,877,158 D190N probably benign Het
Grik3 C A 4: 125,693,970 L628M probably damaging Het
Grik3 T A 4: 125,693,971 L628Q probably damaging Het
Grin2c T A 11: 115,250,643 D883V probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
H2-Eb1 A G 17: 34,309,681 E62G probably damaging Het
Kif1a C T 1: 93,036,853 D1334N possibly damaging Het
Lef1 A G 3: 131,184,758 D175G probably damaging Het
Myom1 A G 17: 71,045,663 probably null Het
Olfr420 A T 1: 174,159,180 M136L probably benign Het
Pgr A T 9: 8,922,629 N600I probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Selp T C 1: 164,123,775 F26S probably benign Het
Tchh A T 3: 93,445,107 D618V unknown Het
Tenm4 A T 7: 96,553,516 M88L probably benign Het
Zfat A T 15: 68,084,553 D1143E probably benign Het
Other mutations in Agmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Agmo APN 12 37357717 missense probably damaging 1.00
IGL01412:Agmo APN 12 37402141 missense possibly damaging 0.49
IGL01682:Agmo APN 12 37357627 splice site probably benign
IGL02263:Agmo APN 12 37357697 missense probably damaging 1.00
IGL02478:Agmo APN 12 37401986 missense probably damaging 1.00
IGL02803:Agmo APN 12 37252481 missense probably benign 0.00
R0664:Agmo UTSW 12 37252572 missense probably damaging 1.00
R2158:Agmo UTSW 12 37357710 missense probably damaging 1.00
R5263:Agmo UTSW 12 37357681 missense probably benign 0.01
R6249:Agmo UTSW 12 37243838 critical splice donor site probably null
R6251:Agmo UTSW 12 37252539 missense probably damaging 1.00
R7513:Agmo UTSW 12 37244353 missense probably benign 0.01
R7686:Agmo UTSW 12 37419974 missense probably benign 0.00
R7729:Agmo UTSW 12 37414975 missense probably benign 0.00
R7731:Agmo UTSW 12 37414940 missense probably benign 0.01
R7849:Agmo UTSW 12 37242045 missense probably benign 0.03
R7852:Agmo UTSW 12 37242052 missense possibly damaging 0.92
R7932:Agmo UTSW 12 37242045 missense probably benign 0.03
R7935:Agmo UTSW 12 37242052 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTAGCCTTCCCAGATATCAGAGAAC -3'
(R):5'- AACACTAGGGATATTGAGCATTCTC -3'

Sequencing Primer
(F):5'- ACTGATCAGAAAATTTAGAGGACTTG -3'
(R):5'- CTCTGCTTTACACTGGGA -3'
Posted On2015-02-18