Incidental Mutation 'R3440:H2-Eb1'
ID267362
Institutional Source Beutler Lab
Gene Symbol H2-Eb1
Ensembl Gene ENSMUSG00000060586
Gene Namehistocompatibility 2, class II antigen E beta
SynonymsH-2Eb, Ia-4, Ia4
MMRRC Submission 040658-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3440 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34305877-34316199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34309681 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 62 (E62G)
Ref Sequence ENSEMBL: ENSMUSP00000074143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074557]
Predicted Effect probably damaging
Transcript: ENSMUST00000074557
AA Change: E62G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074143
Gene: ENSMUSG00000060586
AA Change: E62G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_beta 40 114 4.64e-47 SMART
IGc1 139 210 2.24e-24 SMART
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174074
Meta Mutation Damage Score 0.3090 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DRB5 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. The presence of DRB5 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,041,912 Q4614* probably null Het
Abtb2 C A 2: 103,567,232 A169E probably benign Het
Adam3 T C 8: 24,680,743 probably benign Het
Agmo C T 12: 37,243,800 T74I probably damaging Het
Ano6 T C 15: 95,967,721 V862A probably damaging Het
Cavin2 T A 1: 51,301,406 V414E probably damaging Het
Clrn3 A C 7: 135,514,125 Y165* probably null Het
Cp A T 3: 19,974,957 M533L probably benign Het
Dhrs3 T A 4: 144,920,058 M226K probably damaging Het
Fignl2 A G 15: 101,053,123 F426S unknown Het
Fpr1 C T 17: 17,877,158 D190N probably benign Het
Grik3 C A 4: 125,693,970 L628M probably damaging Het
Grik3 T A 4: 125,693,971 L628Q probably damaging Het
Grin2c T A 11: 115,250,643 D883V probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
Kif1a C T 1: 93,036,853 D1334N possibly damaging Het
Lef1 A G 3: 131,184,758 D175G probably damaging Het
Myom1 A G 17: 71,045,663 probably null Het
Olfr420 A T 1: 174,159,180 M136L probably benign Het
Pgr A T 9: 8,922,629 N600I probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Selp T C 1: 164,123,775 F26S probably benign Het
Tchh A T 3: 93,445,107 D618V unknown Het
Tenm4 A T 7: 96,553,516 M88L probably benign Het
Zfat A T 15: 68,084,553 D1143E probably benign Het
Other mutations in H2-Eb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0724:H2-Eb1 UTSW 17 34315032 splice site probably benign
R0763:H2-Eb1 UTSW 17 34314159 splice site probably benign
R2029:H2-Eb1 UTSW 17 34314392 missense probably damaging 1.00
R3155:H2-Eb1 UTSW 17 34314374 missense probably damaging 0.98
R4050:H2-Eb1 UTSW 17 34314368 missense probably damaging 1.00
R4084:H2-Eb1 UTSW 17 34314443 missense probably damaging 0.98
R5605:H2-Eb1 UTSW 17 34309833 missense probably benign 0.09
R5667:H2-Eb1 UTSW 17 34314255 nonsense probably null
R5671:H2-Eb1 UTSW 17 34314255 nonsense probably null
R5851:H2-Eb1 UTSW 17 34309771 missense probably benign 0.13
R6951:H2-Eb1 UTSW 17 34309857 nonsense probably null
R7387:H2-Eb1 UTSW 17 34314233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGTAGCACAGCTGTAAC -3'
(R):5'- CGCCGCACAAGGAATTTATC -3'

Sequencing Primer
(F):5'- CCTGTTAGTTGTGGAGACCTCAGAAG -3'
(R):5'- ATCCGAGATCTCATAGTTGTGTC -3'
Posted On2015-02-18