Incidental Mutation 'R3441:Epha4'
ID267364
Institutional Source Beutler Lab
Gene Symbol Epha4
Ensembl Gene ENSMUSG00000026235
Gene NameEph receptor A4
Synonymsrb, Sek, Sek1, 2900005C20Rik, Cek8, Hek8, Tyro1
MMRRC Submission 040659-MU
Accession Numbers

Genbank: NM_007936; MGI: 98277

Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock #R3441 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location77367185-77515088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77426696 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 95 (N95K)
Ref Sequence ENSEMBL: ENSMUSP00000140370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000186930] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]
Predicted Effect probably benign
Transcript: ENSMUST00000027451
AA Change: N391K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235
AA Change: N391K

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 548 618 1.7e-24 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186930
AA Change: N95K

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140370
Gene: ENSMUSG00000026235
AA Change: N95K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 33 124 9.6e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188797
AA Change: N391K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235
AA Change: N391K

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188952
AA Change: N391K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235
AA Change: N391K

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189934
Predicted Effect probably benign
Transcript: ENSMUST00000190149
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,680,743 probably benign Het
Ap5b1 A G 19: 5,569,983 H477R probably benign Het
Asz1 A C 6: 18,108,406 S68A probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Btnl6 T C 17: 34,508,318 K413E probably benign Het
Cav3 G A 6: 112,472,441 C140Y possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Clrn3 A C 7: 135,514,125 Y165* probably null Het
Cp A T 3: 19,974,957 M533L probably benign Het
Cyba C T 8: 122,425,064 W103* probably null Het
Fsip2 A G 2: 82,986,727 N4268S probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Hyal6 C T 6: 24,734,593 A175V probably benign Het
Kif1a C T 1: 93,036,853 D1334N possibly damaging Het
Krtap24-1 T C 16: 88,611,825 T138A probably damaging Het
Maats1 T C 16: 38,333,806 M126V probably benign Het
Mrc2 A T 11: 105,347,716 T1230S possibly damaging Het
Mx1 T A 16: 97,456,231 I109F probably damaging Het
Nav3 A G 10: 109,704,928 F1947S probably benign Het
Olfr1112 A G 2: 87,191,818 I44V probably benign Het
Olfr420 A T 1: 174,159,180 M136L probably benign Het
Plxnc1 G A 10: 94,871,010 T555I probably benign Het
Rab21 CCCGCCGCCGCCGCCGCC CCCGCCGCCGCCGCC 10: 115,315,309 probably benign Het
Rag2 T A 2: 101,630,300 F318L probably damaging Het
Scgb2b24 G T 7: 33,738,600 F27L probably damaging Het
Tchh A T 3: 93,445,107 D618V unknown Het
Teddm1b A G 1: 153,875,261 E272G probably benign Het
Tenm4 A T 7: 96,553,516 M88L probably benign Het
Tfpi2 A T 6: 3,965,504 Y103N probably benign Het
Tmem98 A G 11: 80,814,299 N71S probably damaging Het
Vmn1r181 A G 7: 23,984,883 I258V probably benign Het
Other mutations in Epha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Epha4 APN 1 77398557 missense probably benign 0.00
IGL01350:Epha4 APN 1 77506855 missense probably damaging 1.00
IGL01657:Epha4 APN 1 77426838 missense probably damaging 1.00
IGL01872:Epha4 APN 1 77383039 missense probably benign 0.03
IGL02366:Epha4 APN 1 77426711 nonsense probably null
IGL02426:Epha4 APN 1 77444877 missense probably benign 0.01
IGL02428:Epha4 APN 1 77506748 missense possibly damaging 0.94
IGL02706:Epha4 APN 1 77426845 missense probably damaging 1.00
IGL02716:Epha4 APN 1 77380965 missense probably damaging 1.00
IGL03348:Epha4 APN 1 77507172 missense possibly damaging 0.82
frog UTSW 1 77481076 intron probably benign
R0324:Epha4 UTSW 1 77383551 missense probably damaging 1.00
R0392:Epha4 UTSW 1 77506973 missense probably benign 0.00
R0538:Epha4 UTSW 1 77388541 missense probably damaging 1.00
R0562:Epha4 UTSW 1 77388487 missense probably benign 0.00
R0885:Epha4 UTSW 1 77382939 missense probably damaging 0.99
R1509:Epha4 UTSW 1 77380886 missense probably damaging 1.00
R1620:Epha4 UTSW 1 77374926 missense probably benign 0.31
R1624:Epha4 UTSW 1 77399692 missense probably damaging 1.00
R1654:Epha4 UTSW 1 77374768 splice site probably null
R1755:Epha4 UTSW 1 77387823 missense probably damaging 1.00
R1807:Epha4 UTSW 1 77374904 missense probably benign 0.05
R2046:Epha4 UTSW 1 77507162 missense probably damaging 1.00
R2504:Epha4 UTSW 1 77382991 missense probably damaging 1.00
R2509:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R2511:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R3724:Epha4 UTSW 1 77426543 splice site probably benign
R3901:Epha4 UTSW 1 77380902 missense probably damaging 1.00
R3950:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3951:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3952:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R4012:Epha4 UTSW 1 77390094 splice site probably benign
R4321:Epha4 UTSW 1 77507213 critical splice acceptor site probably null
R4422:Epha4 UTSW 1 77511717 missense probably damaging 0.99
R4898:Epha4 UTSW 1 77390075 nonsense probably null
R5072:Epha4 UTSW 1 77445002 missense probably damaging 1.00
R5270:Epha4 UTSW 1 77506607 missense probably damaging 1.00
R5281:Epha4 UTSW 1 77374867 missense probably benign
R5315:Epha4 UTSW 1 77388472 critical splice donor site probably null
R5531:Epha4 UTSW 1 77374876 missense probably benign
R5621:Epha4 UTSW 1 77515049 utr 5 prime probably benign
R5648:Epha4 UTSW 1 77398525 missense probably benign 0.25
R5747:Epha4 UTSW 1 77506883 missense probably damaging 0.99
R5829:Epha4 UTSW 1 77444994 missense probably benign 0.01
R6185:Epha4 UTSW 1 77507106 missense probably damaging 1.00
R6486:Epha4 UTSW 1 77383549 missense probably damaging 1.00
R6821:Epha4 UTSW 1 77382945 missense possibly damaging 0.88
R6978:Epha4 UTSW 1 77377583 missense probably damaging 1.00
R7039:Epha4 UTSW 1 77506785 missense probably damaging 1.00
R7216:Epha4 UTSW 1 77444984 missense probably damaging 1.00
R7270:Epha4 UTSW 1 77399785 missense probably damaging 1.00
R7444:Epha4 UTSW 1 77387916 missense probably damaging 1.00
R7737:Epha4 UTSW 1 77381012 missense probably damaging 1.00
R7763:Epha4 UTSW 1 77390031 critical splice donor site probably null
R7950:Epha4 UTSW 1 77507196 missense probably damaging 0.99
R8297:Epha4 UTSW 1 77506910 missense probably damaging 1.00
R8373:Epha4 UTSW 1 77507079 missense possibly damaging 0.60
R8429:Epha4 UTSW 1 77390036 missense probably benign 0.08
Z1088:Epha4 UTSW 1 77506662 missense possibly damaging 0.61
Z1176:Epha4 UTSW 1 77373733 makesense probably null
Z1176:Epha4 UTSW 1 77383011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCTATGACTTTCTCCAG -3'
(R):5'- GGGGTCCAAAAGGATCTCAG -3'

Sequencing Primer
(F):5'- TGACTTTCTCCAGAAACACTCAGAG -3'
(R):5'- GGTCCAAAAGGATCTCAGTCCTTG -3'
Posted On2015-02-18