Incidental Mutation 'R3441:Olfr1112'
ID267369
Institutional Source Beutler Lab
Gene Symbol Olfr1112
Ensembl Gene ENSMUSG00000044487
Gene Nameolfactory receptor 1112
SynonymsGA_x6K02T2Q125-48676316-48677272, MOR264-6
MMRRC Submission 040659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3441 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87187798-87192767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87191818 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 44 (I44V)
Ref Sequence ENSEMBL: ENSMUSP00000149960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053050] [ENSMUST00000216772]
Predicted Effect probably benign
Transcript: ENSMUST00000053050
AA Change: I44V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052341
Gene: ENSMUSG00000044487
AA Change: I44V

DomainStartEndE-ValueType
Pfam:7tm_4 38 315 2.4e-52 PFAM
Pfam:7tm_1 48 297 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216772
AA Change: I44V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,680,743 probably benign Het
Ap5b1 A G 19: 5,569,983 H477R probably benign Het
Asz1 A C 6: 18,108,406 S68A probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Btnl6 T C 17: 34,508,318 K413E probably benign Het
Cav3 G A 6: 112,472,441 C140Y possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Clrn3 A C 7: 135,514,125 Y165* probably null Het
Cp A T 3: 19,974,957 M533L probably benign Het
Cyba C T 8: 122,425,064 W103* probably null Het
Epha4 G T 1: 77,426,696 N95K possibly damaging Het
Fsip2 A G 2: 82,986,727 N4268S probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Hyal6 C T 6: 24,734,593 A175V probably benign Het
Kif1a C T 1: 93,036,853 D1334N possibly damaging Het
Krtap24-1 T C 16: 88,611,825 T138A probably damaging Het
Maats1 T C 16: 38,333,806 M126V probably benign Het
Mrc2 A T 11: 105,347,716 T1230S possibly damaging Het
Mx1 T A 16: 97,456,231 I109F probably damaging Het
Nav3 A G 10: 109,704,928 F1947S probably benign Het
Olfr420 A T 1: 174,159,180 M136L probably benign Het
Plxnc1 G A 10: 94,871,010 T555I probably benign Het
Rab21 CCCGCCGCCGCCGCCGCC CCCGCCGCCGCCGCC 10: 115,315,309 probably benign Het
Rag2 T A 2: 101,630,300 F318L probably damaging Het
Scgb2b24 G T 7: 33,738,600 F27L probably damaging Het
Tchh A T 3: 93,445,107 D618V unknown Het
Teddm1b A G 1: 153,875,261 E272G probably benign Het
Tenm4 A T 7: 96,553,516 M88L probably benign Het
Tfpi2 A T 6: 3,965,504 Y103N probably benign Het
Tmem98 A G 11: 80,814,299 N71S probably damaging Het
Vmn1r181 A G 7: 23,984,883 I258V probably benign Het
Other mutations in Olfr1112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Olfr1112 APN 2 87191848 missense probably benign 0.00
R0665:Olfr1112 UTSW 2 87192308 missense probably damaging 1.00
R1698:Olfr1112 UTSW 2 87191737 missense probably benign 0.00
R1717:Olfr1112 UTSW 2 87191903 missense probably benign 0.38
R1768:Olfr1112 UTSW 2 87191698 missense probably benign
R1872:Olfr1112 UTSW 2 87191878 missense possibly damaging 0.96
R4017:Olfr1112 UTSW 2 87192502 missense probably benign 0.03
R4895:Olfr1112 UTSW 2 87191848 missense probably benign 0.00
R5451:Olfr1112 UTSW 2 87192452 missense probably damaging 1.00
R6171:Olfr1112 UTSW 2 87192365 missense possibly damaging 0.77
R6851:Olfr1112 UTSW 2 87192469 missense probably benign 0.37
R7263:Olfr1112 UTSW 2 87192132 nonsense probably null
R7622:Olfr1112 UTSW 2 87192250 missense probably benign 0.01
R7659:Olfr1112 UTSW 2 87192365 missense possibly damaging 0.77
R7798:Olfr1112 UTSW 2 87192292 missense probably benign 0.00
R7880:Olfr1112 UTSW 2 87192090 nonsense probably null
R7963:Olfr1112 UTSW 2 87192090 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAATATGACTGGACACCTCTCC -3'
(R):5'- TGTGTAGCACAAGCCATGAAAG -3'

Sequencing Primer
(F):5'- GGACACCTCTCCTGTGTTTGTG -3'
(R):5'- CACAAGCCATGAAAGAAATGATTCTG -3'
Posted On2015-02-18