Incidental Mutation 'R3441:Hyal6'
ID267376
Institutional Source Beutler Lab
Gene Symbol Hyal6
Ensembl Gene ENSMUSG00000029679
Gene Namehyaluronoglucosaminidase 6
Synonyms4932701A20Rik, Hyal-ps1
MMRRC Submission 040659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3441 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location24733245-24745452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24734593 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 175 (A175V)
Ref Sequence ENSEMBL: ENSMUSP00000031690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031690]
Predicted Effect probably benign
Transcript: ENSMUST00000031690
AA Change: A175V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031690
Gene: ENSMUSG00000029679
AA Change: A175V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 30 363 4.8e-136 PFAM
EGF 365 438 6.02e0 SMART
transmembrane domain 457 479 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,680,743 probably benign Het
Ap5b1 A G 19: 5,569,983 H477R probably benign Het
Asz1 A C 6: 18,108,406 S68A probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Btnl6 T C 17: 34,508,318 K413E probably benign Het
Cav3 G A 6: 112,472,441 C140Y possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Clrn3 A C 7: 135,514,125 Y165* probably null Het
Cp A T 3: 19,974,957 M533L probably benign Het
Cyba C T 8: 122,425,064 W103* probably null Het
Epha4 G T 1: 77,426,696 N95K possibly damaging Het
Fsip2 A G 2: 82,986,727 N4268S probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Kif1a C T 1: 93,036,853 D1334N possibly damaging Het
Krtap24-1 T C 16: 88,611,825 T138A probably damaging Het
Maats1 T C 16: 38,333,806 M126V probably benign Het
Mrc2 A T 11: 105,347,716 T1230S possibly damaging Het
Mx1 T A 16: 97,456,231 I109F probably damaging Het
Nav3 A G 10: 109,704,928 F1947S probably benign Het
Olfr1112 A G 2: 87,191,818 I44V probably benign Het
Olfr420 A T 1: 174,159,180 M136L probably benign Het
Plxnc1 G A 10: 94,871,010 T555I probably benign Het
Rab21 CCCGCCGCCGCCGCCGCC CCCGCCGCCGCCGCC 10: 115,315,309 probably benign Het
Rag2 T A 2: 101,630,300 F318L probably damaging Het
Scgb2b24 G T 7: 33,738,600 F27L probably damaging Het
Tchh A T 3: 93,445,107 D618V unknown Het
Teddm1b A G 1: 153,875,261 E272G probably benign Het
Tenm4 A T 7: 96,553,516 M88L probably benign Het
Tfpi2 A T 6: 3,965,504 Y103N probably benign Het
Tmem98 A G 11: 80,814,299 N71S probably damaging Het
Vmn1r181 A G 7: 23,984,883 I258V probably benign Het
Other mutations in Hyal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Hyal6 APN 6 24734179 missense probably damaging 1.00
IGL02269:Hyal6 APN 6 24740859 missense probably damaging 0.97
IGL02729:Hyal6 APN 6 24734695 missense probably damaging 1.00
IGL02793:Hyal6 APN 6 24734379 nonsense probably null
IGL02943:Hyal6 APN 6 24743439 missense probably damaging 0.99
IGL03351:Hyal6 APN 6 24743429 missense probably damaging 1.00
R0481:Hyal6 UTSW 6 24743418 missense probably damaging 1.00
R0517:Hyal6 UTSW 6 24734853 missense probably benign
R0853:Hyal6 UTSW 6 24734073 missense probably benign
R1182:Hyal6 UTSW 6 24743417 missense probably damaging 1.00
R1401:Hyal6 UTSW 6 24743435 missense probably damaging 1.00
R1780:Hyal6 UTSW 6 24734032 splice site probably benign
R1858:Hyal6 UTSW 6 24740858 missense probably benign 0.01
R2011:Hyal6 UTSW 6 24734724 missense possibly damaging 0.69
R4819:Hyal6 UTSW 6 24734966 nonsense probably null
R5357:Hyal6 UTSW 6 24734518 missense probably benign 0.05
R5648:Hyal6 UTSW 6 24734236 missense possibly damaging 0.61
R5717:Hyal6 UTSW 6 24743691 missense probably benign 0.15
R5884:Hyal6 UTSW 6 24743369 missense probably damaging 1.00
R6657:Hyal6 UTSW 6 24734758 missense possibly damaging 0.61
R6826:Hyal6 UTSW 6 24734372 missense probably damaging 1.00
R7178:Hyal6 UTSW 6 24734835 missense probably benign 0.28
R7531:Hyal6 UTSW 6 24740787 missense possibly damaging 0.46
R7630:Hyal6 UTSW 6 24734584 missense probably damaging 1.00
R7787:Hyal6 UTSW 6 24743736 missense probably damaging 0.99
R7851:Hyal6 UTSW 6 24734498 missense probably benign 0.05
R8132:Hyal6 UTSW 6 24740828 missense possibly damaging 0.80
R8200:Hyal6 UTSW 6 24734566 missense probably benign 0.01
R8294:Hyal6 UTSW 6 24734379 missense possibly damaging 0.53
R8300:Hyal6 UTSW 6 24734088 missense probably benign
R8509:Hyal6 UTSW 6 24734606 missense probably damaging 1.00
R8705:Hyal6 UTSW 6 24734674 missense probably benign 0.01
R8917:Hyal6 UTSW 6 24734104 missense possibly damaging 0.96
X0019:Hyal6 UTSW 6 24734667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAATACCTCAGAAAGTGAACC -3'
(R):5'- TCATCATCTGGGCAACTTCCTG -3'

Sequencing Primer
(F):5'- TCAGAAAGTGAACCTCTCTGAG -3'
(R):5'- ATCTGGGCAACTTCCTGTGTAGAAC -3'
Posted On2015-02-18