Incidental Mutation 'R3441:Scgb2b24'
ID267381
Institutional Source Beutler Lab
Gene Symbol Scgb2b24
Ensembl Gene ENSMUSG00000046438
Gene Namesecretoglobin, family 2B, member 24
SynonymsC2b, Abpbg24, Abpz, Scgb2b3
MMRRC Submission 040659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3441 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location33737190-33739312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33738600 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 27 (F27L)
Ref Sequence ENSEMBL: ENSMUSP00000052456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055444]
Predicted Effect probably damaging
Transcript: ENSMUST00000055444
AA Change: F27L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052456
Gene: ENSMUSG00000046438
AA Change: F27L

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
Pfam:Feld-I_B 24 90 5.9e-33 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,680,743 probably benign Het
Ap5b1 A G 19: 5,569,983 H477R probably benign Het
Asz1 A C 6: 18,108,406 S68A probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Btnl6 T C 17: 34,508,318 K413E probably benign Het
Cav3 G A 6: 112,472,441 C140Y possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Clrn3 A C 7: 135,514,125 Y165* probably null Het
Cp A T 3: 19,974,957 M533L probably benign Het
Cyba C T 8: 122,425,064 W103* probably null Het
Epha4 G T 1: 77,426,696 N95K possibly damaging Het
Fsip2 A G 2: 82,986,727 N4268S probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Hyal6 C T 6: 24,734,593 A175V probably benign Het
Kif1a C T 1: 93,036,853 D1334N possibly damaging Het
Krtap24-1 T C 16: 88,611,825 T138A probably damaging Het
Maats1 T C 16: 38,333,806 M126V probably benign Het
Mrc2 A T 11: 105,347,716 T1230S possibly damaging Het
Mx1 T A 16: 97,456,231 I109F probably damaging Het
Nav3 A G 10: 109,704,928 F1947S probably benign Het
Olfr1112 A G 2: 87,191,818 I44V probably benign Het
Olfr420 A T 1: 174,159,180 M136L probably benign Het
Plxnc1 G A 10: 94,871,010 T555I probably benign Het
Rab21 CCCGCCGCCGCCGCCGCC CCCGCCGCCGCCGCC 10: 115,315,309 probably benign Het
Rag2 T A 2: 101,630,300 F318L probably damaging Het
Tchh A T 3: 93,445,107 D618V unknown Het
Teddm1b A G 1: 153,875,261 E272G probably benign Het
Tenm4 A T 7: 96,553,516 M88L probably benign Het
Tfpi2 A T 6: 3,965,504 Y103N probably benign Het
Tmem98 A G 11: 80,814,299 N71S probably damaging Het
Vmn1r181 A G 7: 23,984,883 I258V probably benign Het
Other mutations in Scgb2b24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Scgb2b24 APN 7 33739227 missense probably damaging 0.97
IGL02328:Scgb2b24 APN 7 33738625 splice site probably benign
PIT4618001:Scgb2b24 UTSW 7 33738611 missense probably damaging 0.96
R5874:Scgb2b24 UTSW 7 33737405 missense probably damaging 0.99
R6572:Scgb2b24 UTSW 7 33738477 missense probably damaging 1.00
R6800:Scgb2b24 UTSW 7 33738469 missense probably benign 0.01
R7431:Scgb2b24 UTSW 7 33739249 missense probably benign 0.13
R8096:Scgb2b24 UTSW 7 33739221 splice site probably null
R8458:Scgb2b24 UTSW 7 33737354 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTGCATTGATCATTTGTACACAG -3'
(R):5'- GCTGCAGAAGATGGTTGATGC -3'

Sequencing Primer
(F):5'- GCATTGATCATTTGTACACAGCTTTC -3'
(R):5'- GATGCTTTCTGCTCAGGTTACAACAC -3'
Posted On2015-02-18