Mutagenetix > Incidental Mutation

Incidental Mutation 'R3441:Cdh15'

267386

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

040659-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3441 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123575113-123594136 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 123588763 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 279 (R279Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

probably damaging
Transcript: ENSMUST00000034443
AA Change: R279Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: R279Q

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam3	T	C	8: 25,170,759 (GRCm39)		probably benign	Het
Ap5b1	A	G	19: 5,620,011 (GRCm39)	H477R	probably benign	Het
Asz1	A	C	6: 18,108,405 (GRCm39)	S68A	probably benign	Het
Atp4a	G	A	7: 30,419,650 (GRCm39)	R671Q	probably benign	Het
Btnl6	T	C	17: 34,727,292 (GRCm39)	K413E	probably benign	Het
Cav3	G	A	6: 112,449,402 (GRCm39)	C140Y	possibly damaging	Het
Cfap91	T	C	16: 38,154,168 (GRCm39)	M126V	probably benign	Het
Clrn3	A	C	7: 135,115,854 (GRCm39)	Y165*	probably null	Het
Cp	A	T	3: 20,029,121 (GRCm39)	M533L	probably benign	Het
Cyba	C	T	8: 123,151,803 (GRCm39)	W103*	probably null	Het
Epha4	G	T	1: 77,403,333 (GRCm39)	N95K	possibly damaging	Het
Fsip2	A	G	2: 82,817,071 (GRCm39)	N4268S	probably benign	Het
Glb1l2	C	T	9: 26,692,038 (GRCm39)	A74T	probably damaging	Het
Gtf3c6	T	A	10: 40,127,169 (GRCm39)	E123V	probably null	Het
Htr3b	T	C	9: 48,856,815 (GRCm39)	D221G	probably benign	Het
Hyal6	C	T	6: 24,734,592 (GRCm39)	A175V	probably benign	Het
Kif1a	C	T	1: 92,964,575 (GRCm39)	D1334N	possibly damaging	Het
Krtap24-1	T	C	16: 88,408,713 (GRCm39)	T138A	probably damaging	Het
Mrc2	A	T	11: 105,238,542 (GRCm39)	T1230S	possibly damaging	Het
Mx1	T	A	16: 97,257,431 (GRCm39)	I109F	probably damaging	Het
Nav3	A	G	10: 109,540,789 (GRCm39)	F1947S	probably benign	Het
Or12e1	A	G	2: 87,022,162 (GRCm39)	I44V	probably benign	Het
Or6k2	A	T	1: 173,986,746 (GRCm39)	M136L	probably benign	Het
Plxnc1	G	A	10: 94,706,872 (GRCm39)	T555I	probably benign	Het
Rab21	CCCGCCGCCGCCGCCGCC	CCCGCCGCCGCCGCC	10: 115,151,214 (GRCm39)		probably benign	Het
Rag2	T	A	2: 101,460,645 (GRCm39)	F318L	probably damaging	Het
Scgb2b24	G	T	7: 33,438,025 (GRCm39)	F27L	probably damaging	Het
Tchh	A	T	3: 93,352,414 (GRCm39)	D618V	unknown	Het
Teddm1b	A	G	1: 153,751,007 (GRCm39)	E272G	probably benign	Het
Tenm4	A	T	7: 96,202,723 (GRCm39)	M88L	probably benign	Het
Tfpi2	A	T	6: 3,965,504 (GRCm39)	Y103N	probably benign	Het
Tmem98	A	G	11: 80,705,125 (GRCm39)	N71S	probably damaging	Het
Vmn1r181	A	G	7: 23,684,308 (GRCm39)	I258V	probably benign	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	123,592,062 (GRCm39)	intron	probably benign
IGL01958:Cdh15	APN	8	123,586,089 (GRCm39)	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	123,583,291 (GRCm39)	nonsense	probably null
IGL02793:Cdh15	APN	8	123,587,721 (GRCm39)	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	123,592,111 (GRCm39)	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	123,592,175 (GRCm39)	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	123,587,705 (GRCm39)	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	123,588,188 (GRCm39)	intron	probably benign
R0898:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	123,591,939 (GRCm39)	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	123,591,076 (GRCm39)	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	123,587,585 (GRCm39)	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	123,588,188 (GRCm39)	intron	probably benign
R1317:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	123,588,755 (GRCm39)	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	123,591,715 (GRCm39)	splice site	probably null
R2252:Cdh15	UTSW	8	123,584,161 (GRCm39)	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	123,586,056 (GRCm39)	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R3442:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	123,590,162 (GRCm39)	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	123,590,162 (GRCm39)	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	123,591,897 (GRCm39)	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	123,591,767 (GRCm39)	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	123,587,612 (GRCm39)	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	123,591,087 (GRCm39)	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	123,588,802 (GRCm39)	missense	probably null	1.00
R5375:Cdh15	UTSW	8	123,591,839 (GRCm39)	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	123,591,917 (GRCm39)	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	123,583,326 (GRCm39)	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	123,591,086 (GRCm39)	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	123,584,130 (GRCm39)	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	123,590,294 (GRCm39)	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	123,575,231 (GRCm39)	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	123,588,865 (GRCm39)	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	123,593,700 (GRCm39)	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	123,593,574 (GRCm39)	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	123,584,105 (GRCm39)	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	123,587,628 (GRCm39)	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	123,575,240 (GRCm39)	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	123,584,256 (GRCm39)	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	123,586,029 (GRCm39)	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	123,588,769 (GRCm39)	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	123,591,024 (GRCm39)	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	123,590,998 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCAGTCCAATATCCAGGAGC -3'
(R):5'- TTCTAGCTGAGGGAACACACATG -3'

Sequencing Primer
(F):5'- TGGGATCCATGGCTCTGGAAAC -3'
(R):5'- CACATGACAGGGACAGGGCTC -3'

Posted On

2015-02-18