Incidental Mutation 'R3441:Btnl6'
ID 267398
Institutional Source Beutler Lab
Gene Symbol Btnl6
Ensembl Gene ENSMUSG00000092618
Gene Name butyrophilin-like 6
Synonyms Gm6519, NG13
MMRRC Submission 040659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R3441 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34507804-34517352 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34508318 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 413 (K413E)
Ref Sequence ENSEMBL: ENSMUSP00000074927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075483]
AlphaFold A2CG22
Predicted Effect probably benign
Transcript: ENSMUST00000075483
AA Change: K413E

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074927
Gene: ENSMUSG00000092618
AA Change: K413E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.06e-5 SMART
SCOP:d1c5ch2 151 222 1e-2 SMART
Blast:IG_like 152 228 2e-23 BLAST
transmembrane domain 252 271 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
SPRY 384 509 1.23e-19 SMART
low complexity region 510 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173164
Meta Mutation Damage Score 0.2802 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,680,743 probably benign Het
Ap5b1 A G 19: 5,569,983 H477R probably benign Het
Asz1 A C 6: 18,108,406 S68A probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cav3 G A 6: 112,472,441 C140Y possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Clrn3 A C 7: 135,514,125 Y165* probably null Het
Cp A T 3: 19,974,957 M533L probably benign Het
Cyba C T 8: 122,425,064 W103* probably null Het
Epha4 G T 1: 77,426,696 N95K possibly damaging Het
Fsip2 A G 2: 82,986,727 N4268S probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Hyal6 C T 6: 24,734,593 A175V probably benign Het
Kif1a C T 1: 93,036,853 D1334N possibly damaging Het
Krtap24-1 T C 16: 88,611,825 T138A probably damaging Het
Maats1 T C 16: 38,333,806 M126V probably benign Het
Mrc2 A T 11: 105,347,716 T1230S possibly damaging Het
Mx1 T A 16: 97,456,231 I109F probably damaging Het
Nav3 A G 10: 109,704,928 F1947S probably benign Het
Olfr1112 A G 2: 87,191,818 I44V probably benign Het
Olfr420 A T 1: 174,159,180 M136L probably benign Het
Plxnc1 G A 10: 94,871,010 T555I probably benign Het
Rab21 CCCGCCGCCGCCGCCGCC CCCGCCGCCGCCGCC 10: 115,315,309 probably benign Het
Rag2 T A 2: 101,630,300 F318L probably damaging Het
Scgb2b24 G T 7: 33,738,600 F27L probably damaging Het
Tchh A T 3: 93,445,107 D618V unknown Het
Teddm1b A G 1: 153,875,261 E272G probably benign Het
Tenm4 A T 7: 96,553,516 M88L probably benign Het
Tfpi2 A T 6: 3,965,504 Y103N probably benign Het
Tmem98 A G 11: 80,814,299 N71S probably damaging Het
Vmn1r181 A G 7: 23,984,883 I258V probably benign Het
Other mutations in Btnl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Btnl6 APN 17 34514043 missense probably benign 0.00
IGL02501:Btnl6 APN 17 34515674 missense possibly damaging 0.82
IGL02539:Btnl6 APN 17 34508314 missense probably benign 0.00
IGL02629:Btnl6 APN 17 34514468 missense probably damaging 1.00
IGL02724:Btnl6 APN 17 34508175 nonsense probably null
IGL03366:Btnl6 APN 17 34508179 missense probably damaging 1.00
R0013:Btnl6 UTSW 17 34515531 nonsense probably null
R0025:Btnl6 UTSW 17 34514299 missense probably benign 0.02
R0144:Btnl6 UTSW 17 34514020 missense probably benign 0.29
R0255:Btnl6 UTSW 17 34508503 missense probably benign 0.01
R1474:Btnl6 UTSW 17 34513646 missense probably damaging 1.00
R1757:Btnl6 UTSW 17 34514088 missense probably benign 0.09
R1838:Btnl6 UTSW 17 34515542 missense probably damaging 0.99
R2149:Btnl6 UTSW 17 34514347 missense possibly damaging 0.47
R2994:Btnl6 UTSW 17 34515524 missense possibly damaging 0.82
R3809:Btnl6 UTSW 17 34508228 missense probably benign 0.00
R3936:Btnl6 UTSW 17 34517342 missense probably benign
R4462:Btnl6 UTSW 17 34508057 missense probably damaging 1.00
R4604:Btnl6 UTSW 17 34508461 missense possibly damaging 0.91
R4618:Btnl6 UTSW 17 34514146 missense probably damaging 0.98
R4832:Btnl6 UTSW 17 34513992 missense possibly damaging 0.80
R5369:Btnl6 UTSW 17 34507985 nonsense probably null
R5422:Btnl6 UTSW 17 34514107 missense possibly damaging 0.93
R6046:Btnl6 UTSW 17 34508397 missense probably damaging 1.00
R6170:Btnl6 UTSW 17 34515506 missense probably damaging 0.99
R6385:Btnl6 UTSW 17 34508369 missense probably benign 0.01
R8213:Btnl6 UTSW 17 34508883 splice site probably null
R8676:Btnl6 UTSW 17 34508069 missense probably benign 0.00
R8895:Btnl6 UTSW 17 34515417 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCAGAGAAGGAAGCCTTAG -3'
(R):5'- CTTGCCATCTCCCAGGATAG -3'

Sequencing Primer
(F):5'- CATGTCACTCATGTTATAGAAGGAG -3'
(R):5'- ATCTCCCAGGATAGGCTGACTG -3'
Posted On 2015-02-18