Incidental Mutation 'R3441:Ap5b1'
ID267399
Institutional Source Beutler Lab
Gene Symbol Ap5b1
Ensembl Gene ENSMUSG00000049562
Gene Nameadaptor-related protein complex 5, beta 1 subunit
SynonymsGm962
MMRRC Submission 040659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3441 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5568074-5571261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5569983 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 477 (H477R)
Ref Sequence ENSEMBL: ENSMUSP00000094042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096318]
Predicted Effect probably benign
Transcript: ENSMUST00000096318
AA Change: H477R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094042
Gene: ENSMUSG00000049562
AA Change: H477R

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 68 75 N/A INTRINSIC
low complexity region 84 104 N/A INTRINSIC
low complexity region 114 136 N/A INTRINSIC
low complexity region 185 199 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
low complexity region 511 524 N/A INTRINSIC
low complexity region 616 644 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,680,743 probably benign Het
Asz1 A C 6: 18,108,406 S68A probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Btnl6 T C 17: 34,508,318 K413E probably benign Het
Cav3 G A 6: 112,472,441 C140Y possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Clrn3 A C 7: 135,514,125 Y165* probably null Het
Cp A T 3: 19,974,957 M533L probably benign Het
Cyba C T 8: 122,425,064 W103* probably null Het
Epha4 G T 1: 77,426,696 N95K possibly damaging Het
Fsip2 A G 2: 82,986,727 N4268S probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Hyal6 C T 6: 24,734,593 A175V probably benign Het
Kif1a C T 1: 93,036,853 D1334N possibly damaging Het
Krtap24-1 T C 16: 88,611,825 T138A probably damaging Het
Maats1 T C 16: 38,333,806 M126V probably benign Het
Mrc2 A T 11: 105,347,716 T1230S possibly damaging Het
Mx1 T A 16: 97,456,231 I109F probably damaging Het
Nav3 A G 10: 109,704,928 F1947S probably benign Het
Olfr1112 A G 2: 87,191,818 I44V probably benign Het
Olfr420 A T 1: 174,159,180 M136L probably benign Het
Plxnc1 G A 10: 94,871,010 T555I probably benign Het
Rab21 CCCGCCGCCGCCGCCGCC CCCGCCGCCGCCGCC 10: 115,315,309 probably benign Het
Rag2 T A 2: 101,630,300 F318L probably damaging Het
Scgb2b24 G T 7: 33,738,600 F27L probably damaging Het
Tchh A T 3: 93,445,107 D618V unknown Het
Teddm1b A G 1: 153,875,261 E272G probably benign Het
Tenm4 A T 7: 96,553,516 M88L probably benign Het
Tfpi2 A T 6: 3,965,504 Y103N probably benign Het
Tmem98 A G 11: 80,814,299 N71S probably damaging Het
Vmn1r181 A G 7: 23,984,883 I258V probably benign Het
Other mutations in Ap5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Ap5b1 APN 19 5570979 nonsense probably null
IGL02121:Ap5b1 APN 19 5570787 missense possibly damaging 0.92
R1513:Ap5b1 UTSW 19 5569864 nonsense probably null
R2004:Ap5b1 UTSW 19 5570474 missense possibly damaging 0.83
R2036:Ap5b1 UTSW 19 5568869 missense possibly damaging 0.83
R2282:Ap5b1 UTSW 19 5569637 missense possibly damaging 0.66
R3835:Ap5b1 UTSW 19 5568890 missense possibly damaging 0.66
R4241:Ap5b1 UTSW 19 5568797 missense possibly damaging 0.92
R5324:Ap5b1 UTSW 19 5569835 missense possibly damaging 0.66
R5359:Ap5b1 UTSW 19 5569098 missense possibly damaging 0.83
R7102:Ap5b1 UTSW 19 5570187 missense possibly damaging 0.92
R7132:Ap5b1 UTSW 19 5569384 nonsense probably null
R8548:Ap5b1 UTSW 19 5571095 missense possibly damaging 0.46
Z1088:Ap5b1 UTSW 19 5570424 missense possibly damaging 0.82
Z1177:Ap5b1 UTSW 19 5570928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATGACCCAACGGTTCTC -3'
(R):5'- ATCTGCAGGTGCCAGCAAAG -3'

Sequencing Primer
(F):5'- ACCCAACGGTTCTCCTGGC -3'
(R):5'- AGGGCTTCGCTCTCGCC -3'
Posted On2015-02-18